Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR2 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1 8 3
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579 2 2
Bacillus clausii KSM-K16 6 3
Bacillus halodurans C-125 7 4
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426 7 3
Oceanobacillus iheyensis HTE831 2 2
Paenibacillus sp. JDR-2 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nplT
*
Anoxybacillus flavithermus WK1

Site:
position = -228
score = 6.44067
sequence = TTGCGAAAACGATTGCACAA

Gene: Aflv_2192: Neopullulanase (EC 3.2.1.135)
 
Bacillus amyloliquefaciens FZB42
*
Bacillus cereus ATCC 14579

Site:
position = -233
score = 5.79595
sequence = CTATGAAAACGTTTGCGCTA

Gene: BC4014: Neopullulanase (EC 3.2.1.135)
*
Bacillus clausii KSM-K16

Site:
position = -221
score = 6.09429
sequence = TGGTGAAATCGTTTGCACAA

Gene: ABC4031: Neopullulanase (EC 3.2.1.135)
*
Bacillus halodurans C-125

Site:
position = -254
score = 6.05925
sequence = TTAGGAAATCGTTTGCACAA

Gene: BH2927: Neopullulanase (EC 3.2.1.135)
 
Bacillus licheniformis DSM 13

Gene: BLi00658: Neopullulanase (EC 3.2.1.135)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34620: Neopullulanase (EC 3.2.1.135)
*
Geobacillus kaustophilus HTA426

Site:
position = -201
score = 5.51026
sequence = TAAGGAAAACGTTTGCGCAA

Site:
position = -164
score = 5.79978
sequence = CTATGAAAACGATTGCACCA

Gene: GK0703: Neopullulanase (EC 3.2.1.135)
*
Oceanobacillus iheyensis HTE831

Site:
position = -230
score = 4.9846
sequence = TTGCGCAACCGGTTGCACAT

Site:
position = -176
score = 6.0339
sequence = TTACGCAAGCGCTTTCACAA

Gene: OB2561: Neopullulanase (EC 3.2.1.135)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1045: Neopullulanase (EC 3.2.1.135)
Neopullulanase (EC 3.2.1.135)
 
CRON 2.
malE
*
Anoxybacillus flavithermus WK1

Site:
position = 91
score = 6.19868
sequence = TTGTGCAATCGTTTTCGCAA

Gene: Aflv_2191: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -89
score = 6.17098
sequence = TTGTGCAAACGATTTCACCA

Gene: ABC4030: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Bacillus halodurans C-125

Site:
position = -87
score = 6.18357
sequence = TTGTGCAAACGATTTCCTAA

Gene: BH2926: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
*
Geobacillus kaustophilus HTA426

Site:
position = -101
score = 5.33133
sequence = TGGTGCAATCGTTTTCATAG

Site:
position = -64
score = 5.96442
sequence = TTGCGCAAACGTTTTCCTTA

Gene: GK0704: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Oceanobacillus iheyensis HTE831

Site:
position = -126
score = 6.04572
sequence = TTGTGAAAGCGCTTGCGTAA

Gene: OB2560: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0961: Maltose/maltodextrin ABC transporter, substrate-binding protein
Maltose/maltodextrin ABC transporter, substrate-binding protein
malF
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2190: Maltose/maltodextrin ABC transporter, permease protein 1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC4029: Maltose/maltodextrin ABC transporter, permease protein 1
 
Bacillus halodurans C-125

Gene: BH2925: Maltose/maltodextrin ABC transporter, permease protein 1
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK0705: Maltose/maltodextrin ABC transporter, permease protein 1
 
Oceanobacillus iheyensis HTE831

Gene: OB2559: Maltose/maltodextrin ABC transporter, permease protein 1
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0962: Maltose/maltodextrin ABC transporter, permease protein 1
Maltose/maltodextrin ABC transporter, permease protein 1
malG
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2189: Maltose/maltodextrin ABC transporter, permease protein 2
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC4028: Maltose/maltodextrin ABC transporter, permease protein 2
 
Bacillus halodurans C-125

Gene: BH2924: Maltose/maltodextrin ABC transporter, permease protein 2
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK0706: Maltose/maltodextrin ABC transporter, permease protein 2
 
Oceanobacillus iheyensis HTE831

Gene: OB2558: Maltose/maltodextrin ABC transporter, permease protein 2
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0963: Maltose/maltodextrin ABC transporter, permease protein 2
Maltose/maltodextrin ABC transporter, permease protein 2
nplT2
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2188: Neopullulanase (EC 3.2.1.135)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK0707: Neopullulanase (EC 3.2.1.135)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Neopullulanase (EC 3.2.1.135)
Aflv_2187
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2187: Alpha-glucosidase (EC 3.2.1.20)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alpha-glucosidase (EC 3.2.1.20)
malR2
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2186: Maltose utilization transcriptional regulator MalR2, LacI family
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579

Gene: BC4010: Maltose utilization transcriptional regulator MalR2, LacI family
 
Bacillus clausii KSM-K16

Gene: ABC4027: Maltose utilization transcriptional regulator MalR2, LacI family
 
Bacillus halodurans C-125

Gene: BH2923: Maltose utilization transcriptional regulator MalR2, LacI family
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK0708: Maltose utilization transcriptional regulator MalR2, LacI family
 
Oceanobacillus iheyensis HTE831

Gene: OB2557: Maltose utilization transcriptional regulator MalR2, LacI family
 
Paenibacillus sp. JDR-2
Maltose utilization transcriptional regulator MalR2, LacI family
 
CRON 3.
BH0413
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -44
score = 5.95194
sequence = TTGTGCAAACGTTTGCTTAA

Gene: ABC1611: Predicted alpha-amylase precusrsor
*
Bacillus halodurans C-125

Site:
position = -41
score = 6.26917
sequence = TTGTGCAAACGTTTGCCTAA

Gene: BH0413: Predicted alpha-amylase precusrsor
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted alpha-amylase precusrsor
 
CRON 4.
malL
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
*
Bacillus cereus ATCC 14579

Site:
position = -63
score = 4.90879
sequence = TAATGAAAACGTTTGCGCCT

Site:
position = -241
score = 5.04573
sequence = TTATGCAAACGTTTTCTTTG

Gene: BC4015: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Bacillus clausii KSM-K16
*
Bacillus halodurans C-125

Site:
position = -32
score = 5.41834
sequence = TTACGTAAACGTTTTCGTTA

Gene: BH2903: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Oligo-1,6-glucosidase (EC 3.2.1.10)
 
CRON 5.
amyA
*
Anoxybacillus flavithermus WK1

Site:
position = -52
score = 5.16826
sequence = TTGTGCAAACGGTTTCGCTT

Gene: Aflv_2609: Maltodextrin glucosidase (EC 3.2.1.20)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
*
Geobacillus kaustophilus HTA426

Site:
position = -50
score = 6.48832
sequence = TTGTGCAAACGATTGCACAA

Site:
position = -286
score = 5.02826
sequence = TAAGGGAAACGATTGCATAA

Site:
position = -76
score = 5.58063
sequence = TGATGAAATCGTTTGCATCA

Gene: GK3180: Maltodextrin glucosidase (EC 3.2.1.20)
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -50
score = 6.23663
sequence = TTGTGCAATCGTTTGCCCAA

Gene: Pjdr2_5200: Maltodextrin glucosidase (EC 3.2.1.20)
Maltodextrin glucosidase (EC 3.2.1.20)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD