Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog KojR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1 6 2
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16
Bacillus halodurans C-125 5 2
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
kojP
*
Anoxybacillus flavithermus WK1

Site:
position = -13
score = 6.78028
sequence = AATCCGAAACGTTTTGGGAA

Gene: Aflv_2025: Kojibiose phosphorylase (EC 2.4.1.230)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Kojibiose phosphorylase (EC 2.4.1.230)
pgmB
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2024: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13

Gene: BLi00665: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34550: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Beta-phosphoglucomutase (EC 5.4.2.6)
kojE
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2023: Kojibiose ABC transporter, substrate-binding protein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125

Gene: BH3690: Kojibiose ABC transporter, substrate-binding protein
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Kojibiose ABC transporter, substrate-binding protein
kojF
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2022: Kojibiose ABC transporter, permease protein 1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125

Gene: BH3689: Kojibiose ABC transporter, permease protein 1
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Kojibiose ABC transporter, permease protein 1
kojG
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2021: Kojibiose ABC transporter, permease protein 2
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125

Gene: BH3688: Kojibiose ABC transporter, permease protein 2
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Kojibiose ABC transporter, permease protein 2
gdb1
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
*
Bacillus halodurans C-125

Site:
position = -153
score = 6.96966
sequence = AAACCGAAACGTTTTGGATT

Site:
position = -55
score = 5.51561
sequence = GATCCAAAACGTTTCGGATG

Gene: BH3691: Glycogen debranching enzyme
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Glycogen debranching enzyme
 
CRON 2.
kojR
*
Anoxybacillus flavithermus WK1

Site:
position = -13
score = 7.20163
sequence = AATCCGAAACGTTTTGGAGG

Gene: Aflv_2026: Kojibiose transcriptional regulator KojR, LacI family
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
*
Bacillus halodurans C-125

Site:
position = -26
score = 7.01225
sequence = CAACCGAAACGTTTTGGAGG

Gene: BH3692: Kojibiose transcriptional regulator KojR, LacI family
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Kojibiose transcriptional regulator KojR, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD