Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog KojR - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anaerocellum thermophilum DSM 6725 6 2
Caldicellulosiruptor saccharolyticus DSM 8903 6 2
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514 6 2
Thermoanaerobacter italicus Ab9 6 2
Thermoanaerobacter tengcongensis MB4 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
kojP
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0398: Kojibiose phosphorylase (EC 2.4.1.230)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0439: Kojibiose phosphorylase (EC 2.4.1.230)
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -51
score = 6.21073
sequence = TACCCAAAACGTTTCGGATA

Gene: Teth514_2202: Kojibiose phosphorylase (EC 2.4.1.230)
*
Thermoanaerobacter italicus Ab9

Site:
position = -49
score = 6.31471
sequence = TATCCAAAACGTTTCGGATA

Gene: Thit_0754: Kojibiose phosphorylase (EC 2.4.1.230)
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -45
score = 6.26502
sequence = CATCCAAAACGTTTCGGATA

Gene: TTE0798: Kojibiose phosphorylase (EC 2.4.1.230)
Kojibiose phosphorylase (EC 2.4.1.230)
kojE
*
Anaerocellum thermophilum DSM 6725

Site:
position = -181
score = 5.13323
sequence = TTACGAAAACATTTCGAAAA

Site:
position = -48
score = 5.60606
sequence = CATCGAAAACATTTCCGAAA

Gene: Athe_0399: Kojibiose ABC transporter, substrate-binding protein
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -53
score = 5.1531
sequence = TGTCGAAAACATTTCCGAAA

Gene: Csac_0440: Kojibiose ABC transporter, substrate-binding protein
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2201: Kojibiose ABC transporter, substrate-binding protein
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0755: Kojibiose ABC transporter, substrate-binding protein
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0799: Kojibiose ABC transporter, substrate-binding protein
Kojibiose ABC transporter, substrate-binding protein
kojF
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0400: Kojibiose ABC transporter, permease protein 1
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0441: Kojibiose ABC transporter, permease protein 1
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2200: Kojibiose ABC transporter, permease protein 1
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0756: Kojibiose ABC transporter, permease protein 1
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0800: Kojibiose ABC transporter, permease protein 1
Kojibiose ABC transporter, permease protein 1
kojG
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0401: Kojibiose ABC transporter, permease protein 2
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0442: Kojibiose ABC transporter, permease protein 2
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2199: Kojibiose ABC transporter, permease protein 2
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0757: Kojibiose ABC transporter, permease protein 2
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0801: Kojibiose ABC transporter, permease protein 2
Kojibiose ABC transporter, permease protein 2
pgmB
*
Anaerocellum thermophilum DSM 6725

Site:
position = -70
score = 4.79936
sequence = TATTGAAAACAATTCGAAAA

Gene: Athe_0397: Beta-phosphoglucomutase (EC 5.4.2.6)
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -71
score = 4.79936
sequence = TATTGAAAACAATTCGAAAA

Gene: Csac_0438: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2198: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0758: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0802: Beta-phosphoglucomutase (EC 5.4.2.6)
Beta-phosphoglucomutase (EC 5.4.2.6)
kojR
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0402: Kojibiose utilization transcriptional regulator KojR, LacI family
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0443: Kojibiose utilization transcriptional regulator KojR, LacI family
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -33
score = 6.65503
sequence = CAACCAAAACGTTTTGGAAA

Gene: Teth514_2203: Kojibiose utilization transcriptional regulator KojR, LacI family
*
Thermoanaerobacter italicus Ab9

Site:
position = -33
score = 6.65503
sequence = CAACCAAAACGTTTTGGAAA

Gene: Thit_0753: Kojibiose utilization transcriptional regulator KojR, LacI family
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -31
score = 6.41169
sequence = TAACCAAAACGTTTTGGGAA

Gene: TTE0797: Kojibiose utilization transcriptional regulator KojR, LacI family
Kojibiose utilization transcriptional regulator KojR, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD