Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 14 10
Streptomyces coelicolor A3(2) 15 12
Streptomyces griseus subsp. griseus NBRC 13350 11 6
Streptomyces scabiei 87.22 14 11
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cel1
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -54
score = 5.99719
sequence = ATTTGGGAGCGCTCCCATTC

Gene: SCO0765: Secreted endoglucanase
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -93
score = 5.85688
sequence = AATTGGGAGCGCTCCCACTT

Gene: SCAB_8871: Secreted endoglucanase
Secreted endoglucanase
 
CRON 2.
cbhB
*
Streptomyces avermitilis MA-4680

Site:
position = -75
score = 6.27626
sequence = ATATGGGAGCGCTCCCACTG

Site:
position = -218
score = 5.14929
sequence = TGATGGAATCGCTCCCACTG

Gene: SAV_1855: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
*
Streptomyces coelicolor A3(2)

Site:
position = -79
score = 6.51351
sequence = CTATGGGAGCGCTCCCACTG

Site:
position = -221
score = 5.14929
sequence = TGATGGAACCGCTCCCACTG

Gene: SCO6546: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
 
Streptomyces griseus subsp. griseus NBRC 13350
*2
Streptomyces scabiei 87.22

Site:
position = -108
score = 6.48089
sequence = TCATGGGAGCGCTCCCACTG

Site:
position = -251
score = 4.71983
sequence = GTCGGGAACCGCTCCCACTG

Gene: SCAB_90091: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)

Site:
position = -133
score = 6.27626
sequence = ATATGGGAGCGCTCCCACTG

Site:
position = -286
score = 5.26179
sequence = TGGTGGAACCGCTCCCACTG

Gene: SCAB_17011: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
celA3
 
Streptomyces avermitilis MA-4680

Gene: SAV_1856: Predicted endo-1,4-beta-glucanase
 
Streptomyces coelicolor A3(2)

Gene: SCO6545: Predicted endo-1,4-beta-glucanase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_17021: Predicted endo-1,4-beta-glucanase
Predicted endo-1,4-beta-glucanase
 
CRON 3.
celR
*
Streptomyces avermitilis MA-4680

Site:
position = -284
score = 6.69021
sequence = CCGTGGGAGCGCTCCCACAA

Gene: SAV_5257: Cellobiose utilization transcriptional regulator CelR, LacI family
*2
Streptomyces coelicolor A3(2)

Site:
position = -238
score = 6.64156
sequence = GTGTGGGAGCGCTCCCACAA

Gene: SCO2794: Cellobiose utilization transcriptional regulator CelR, LacI family

Gene: SCO7554: Cellobiose utilization transcriptional regulator CelR, LacI family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -109
score = 6.19777
sequence = TCTTGGGAGCGCTCCCAATA

Gene: SGR_4739: Cellobiose utilization transcriptional regulator CelR, LacI family
 2
Streptomyces scabiei 87.22

Gene: SCAB_57761: Cellobiose utilization transcriptional regulator CelR, LacI family

Gene: SCAB_2431: Cellobiose utilization transcriptional regulator CelR, LacI family
Cellobiose utilization transcriptional regulator CelR, LacI family
 
CRON 4.
SCO7559
*
Streptomyces avermitilis MA-4680

Site:
position = -69
score = 5.37518
sequence = CTCTGAGAGCGCTCTCAATT

Gene: SAV_1053: Putative sugar hydrolase
*
Streptomyces coelicolor A3(2)

Site:
position = -62
score = 5.41538
sequence = CGCTGAGAGCGCTCTCAGAA

Gene: SCO7559: Putative sugar hydrolase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
Putative sugar hydrolase
 
CRON 5.
SCO0716
*
Streptomyces avermitilis MA-4680

Site:
position = -102
score = 5.11229
sequence = TTCAGAGAGCGCTCTCAGAC

Gene: SAV_967: Putative glycosyl hydrolase
*
Streptomyces coelicolor A3(2)

Site:
position = -53
score = 5.67928
sequence = GCGTGAGAGCGCTCTCAGGC

Gene: SCO0716: Putative glycosyl hydrolase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
Putative glycosyl hydrolase
 
CRON 6.
gunA2
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -87
score = 6.02346
sequence = AAGTGGGAGCGCTCCCATCA

Site:
position = -61
score = 5.33597
sequence = AGTTGGGAGCGCTCCCGCAC

Gene: SCO1187: Endoglucanase A (EC 3.2.1.4)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -85
score = 6.07845
sequence = AAATGGGAGCGCTCCCAAAG

Gene: SCAB_5981: Endoglucanase A (EC 3.2.1.4)
Endoglucanase A (EC 3.2.1.4)
 
CRON 7.
celA1
*
Streptomyces avermitilis MA-4680

Site:
position = -220
score = 6.29459
sequence = TTTTGGGAGCGCTCCCAAGA

Site:
position = -75
score = 5.9422
sequence = GAATGGGAGCGCTCCCACCT

Site:
position = -51
score = 5.46072
sequence = TGATGGGAGCGCTCCCGAAC

Gene: SAV_555: Endoglucanase (EC 3.2.1.4)
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -63
score = 6.11651
sequence = TCTTGGGAGCGCTCCCAATC

Gene: SCAB_90081: Endoglucanase (EC 3.2.1.4)
Endoglucanase (EC 3.2.1.4)
 
CRON 8.
celA2
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -33
score = 6.34693
sequence = GATTGGGAGCGCTCCCACAG

Gene: SGR_2445: Endoglucanase (EC 3.2.1.4)
*
Streptomyces scabiei 87.22

Site:
position = -131
score = 5.13041
sequence = TACTGGAAGCGCTTCCAATG

Site:
position = -116
score = 6.02346
sequence = CAATGGGAGCGCTCCCACCT

Gene: SCAB_16431: Endoglucanase (EC 3.2.1.4)
Endoglucanase (EC 3.2.1.4)
 
CRON 9.
lamA1
*
Streptomyces avermitilis MA-4680

Site:
position = -60
score = 5.68507
sequence = TCTTGAGAGCGCTCTCAAGG

Gene: SAV_1764: Predicted endo-1,3-beta-glucanase
*
Streptomyces coelicolor A3(2)

Site:
position = -85
score = 5.66818
sequence = CTCTGAGAGCGCTCTCAGAA

Gene: SCO6665: Predicted endo-1,3-beta-glucanase
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -140
score = 5.67662
sequence = TTTTGAGAGCGCTCTCAGGA

Gene: SCAB_15711: Predicted endo-1,3-beta-glucanase
Predicted endo-1,3-beta-glucanase
 
CRON 10.
SCO7637
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = 29
score = 6.15972
sequence = CTTTGGGAGCGCTCCCATCG

Gene: SCO7637: Secreted endoglucanase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
Secreted endoglucanase
 
CRON 11.
SCO0643
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -74
score = 6.26602
sequence = CCTTGGGAGCGCTCCCATGC

Gene: SCO0643: Putative secreted cellulose-binding protein
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
Putative secreted cellulose-binding protein
 
CRON 12.
celA2
*
Streptomyces avermitilis MA-4680

Site:
position = -209
score = 6.27626
sequence = CAGTGGGAGCGCTCCCATAT

Site:
position = -66
score = 5.14929
sequence = CAGTGGGAGCGATTCCATCA

Gene: SAV_1854: Predicted endo-1,4-beta-glucanase
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
Predicted endo-1,4-beta-glucanase
cbhA
 
Streptomyces avermitilis MA-4680

Gene: SAV_1853: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
*
Streptomyces coelicolor A3(2)

Site:
position = -318
score = 5.14929
sequence = CAGTGGGAGCGGTTCCATCA

Gene: SCO6548: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -314
score = 6.27626
sequence = CAGTGGGAGCGCTCCCATAT

Site:
position = -161
score = 5.26179
sequence = CAGTGGGAGCGGTTCCACCA

Gene: SCAB_17001: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
 
CRON 13.
cebE
*
Streptomyces avermitilis MA-4680

Site:
position = -134
score = 6.69021
sequence = TTGTGGGAGCGCTCCCACGG

Gene: SAV_5256: Cellobiose specific ABC transporter, substrate-binding protein
*2
Streptomyces coelicolor A3(2)

Site:
position = -147
score = 6.64156
sequence = TTGTGGGAGCGCTCCCACAC

Gene: SCO2795: Cellobiose specific ABC transporter, substrate-binding protein

Gene: SCO7555: Cellobiose specific ABC transporter, substrate-binding protein
*2
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -55
score = 5.48044
sequence = ATTTGAGAGCGCTCTCAAGG

Gene: SGR_3212: Cellobiose specific ABC transporter, substrate-binding protein

Site:
position = -124
score = 6.31836
sequence = GCATGGGAGCGCTCCCACTC

Gene: SGR_4735: Cellobiose specific ABC transporter, substrate-binding protein
*2
Streptomyces scabiei 87.22

Gene: SCAB_2421: Cellobiose specific ABC transporter, substrate-binding protein

Site:
position = -133
score = 6.69021
sequence = TCGTGGGAGCGCTCCCACAG

Gene: SCAB_57751: Cellobiose specific ABC transporter, substrate-binding protein
Cellobiose specific ABC transporter, substrate-binding protein
cebF
 
Streptomyces avermitilis MA-4680

Gene: SAV_5255: Cellobiose specific ABC transporter, permease protein 1
 2
Streptomyces coelicolor A3(2)

Gene: SCO2796: Cellobiose specific ABC transporter, permease protein 1

Gene: SCO7556: Cellobiose specific ABC transporter, permease protein 1
 2
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3213: Cellobiose specific ABC transporter, permease protein 1

Gene: SGR_4736: Cellobiose specific ABC transporter, permease protein 1
 2
Streptomyces scabiei 87.22

Gene: SCAB_2411: Cellobiose specific ABC transporter, permease protein 1

Gene: SCAB_57741: Cellobiose specific ABC transporter, permease protein 1
Cellobiose specific ABC transporter, permease protein 1
cebG
 
Streptomyces avermitilis MA-4680

Gene: SAV_5254: Cellobiose specific ABC transporter, permease protein 2
 2
Streptomyces coelicolor A3(2)

Gene: SCO2797: Cellobiose specific ABC transporter, permease protein 2

Gene: SCO7557: Cellobiose specific ABC transporter, permease protein 2
 2
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3214: Cellobiose specific ABC transporter, permease protein 2

Gene: SGR_4737: Cellobiose specific ABC transporter, permease protein 2
 2
Streptomyces scabiei 87.22

Gene: SCAB_2401: Cellobiose specific ABC transporter, permease protein 2

Gene: SCAB_57731: Cellobiose specific ABC transporter, permease protein 2
Cellobiose specific ABC transporter, permease protein 2
bglC2
*
Streptomyces avermitilis MA-4680

Site:
position = -88
score = 5.6501
sequence = CGATGGGAGCGCTTCCATGC

Gene: SAV_5253: Beta-glucosidase (EC 3.2.1.21)
*2
Streptomyces coelicolor A3(2)

Site:
position = -16
score = 5.9029
sequence = CTATGGGAGCGCTTCCATGC

Gene: SCO2798: Beta-glucosidase (EC 3.2.1.21)

Gene: SCO7558: Beta-glucosidase (EC 3.2.1.21)
*2
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -18
score = 5.73947
sequence = CCCAGGGAGCGCTCCCACAT

Gene: SGR_4738: Beta-glucosidase (EC 3.2.1.21)

Gene: SGR_3215: Beta-glucosidase (EC 3.2.1.21)
*2
Streptomyces scabiei 87.22

Gene: SCAB_2391: Beta-glucosidase (EC 3.2.1.21)

Site:
position = -16
score = 5.80608
sequence = CAATGGGAGCGCTTCCATGC

Gene: SCAB_57721: Beta-glucosidase (EC 3.2.1.21)
Beta-glucosidase (EC 3.2.1.21)
 
CRON 14.
gunA
*
Streptomyces avermitilis MA-4680

Site:
position = 3
score = 5.88303
sequence = AGGTGGGAGCGCTCCCATAT

Gene: SAV_2254: Endoglucanase A (EC 3.2.1.4)
 
Streptomyces coelicolor A3(2)

Gene: SCO1188: Endoglucanase A (EC 3.2.1.4)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -334
score = 6.16544
sequence = GTGTGGGAGCGCTCCCAGAT

Gene: SGR_199: Endoglucanase A (EC 3.2.1.4)
*
Streptomyces scabiei 87.22

Site:
position = -180
score = 6.0064
sequence = GGGTGGGAGCGCTCCCATGT

Gene: SCAB_21081: Endoglucanase A (EC 3.2.1.4)
Endoglucanase A (EC 3.2.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD