Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824
Clostridium beijerincki NCIMB 8052 4 1
Clostridium botulinum A str. ATCC 3502
Clostridium butyricum 5521
Clostridium kluyveri DSM 555
Clostridium novyi NT
Clostridium perfringens ATCC 13124 4 1
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrA
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -68
score = 6.66501
sequence = ATATGGAACTGGTATCATAT

Gene: Cbei_5012: Sucrose specific PTS system, IIABC component (EC 2.7.1.69)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -244
score = 5.93541
sequence = TTATGAAACTAATTCCATAT

Site:
position = -71
score = 6.66501
sequence = ATATGGAACTGATACCATAT

Gene: CPF_1785: Sucrose specific PTS system, IIABC component (EC 2.7.1.69)
 
Clostridium tetani E88
Sucrose specific PTS system, IIABC component (EC 2.7.1.69)
scrR
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_5011: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3743: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_1784: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Clostridium tetani E88
Sucrose utilization transcriptional regulator ScrR, LacI family
scrB
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_5010: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3744: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_1783: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Clostridium tetani E88
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrK
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_5009: Fructokinase (EC 2.7.1.4)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3745: Fructokinase (EC 2.7.1.4)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_1782: Fructokinase (EC 2.7.1.4)
 
Clostridium tetani E88
Fructokinase (EC 2.7.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD