Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR2 - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824
Clostridium beijerincki NCIMB 8052 5 3
Clostridium botulinum A str. ATCC 3502 4 2
Clostridium butyricum 5521 7 3
Clostridium kluyveri DSM 555
Clostridium novyi NT
Clostridium perfringens ATCC 13124 3 1
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
amyE
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -177
score = 5.86375
sequence = TTGTGCAACCGATTGCAATA

Site:
position = -39
score = 5.56981
sequence = TTTTGCAACCGATTGCGCTA

Gene: Cbei_0664: Alpha-amylase (EC 3.2.1.1)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_0226: Alpha-amylase (EC 3.2.1.1)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Alpha-amylase (EC 3.2.1.1)
 
CRON 2.
malL
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -79
score = 6.51634
sequence = TTGCGCAAACGATTGCTCAA

Gene: CBO1604: Alpha-glucosidase (EC 3.2.1.20)
*
Clostridium butyricum 5521

Site:
position = -233
score = 6.33651
sequence = TAGTGCAAGCGATTGCAAAA

Gene: CBY_2945: Alpha-glucosidase (EC 3.2.1.20)
 
Clostridium kluyveri DSM 555

Gene: CKL_1598: Alpha-glucosidase (EC 3.2.1.20)
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -68
score = 5.76376
sequence = GTGGGCAAACGTTTGCACAT

Gene: CPF_0421: Alpha-glucosidase (EC 3.2.1.20)
 
Clostridium tetani E88
Alpha-glucosidase (EC 3.2.1.20)
ptsG
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1605: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
 
Clostridium butyricum 5521

Gene: CBY_2946: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_0422: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
 
Clostridium tetani E88
PTS system glucose-specific EIICBA component (EC 2.7.1.69)
rgfB
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1606: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Clostridium butyricum 5521

Gene: CBY_2947: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_0423: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Clostridium tetani E88
Exodeoxyribonuclease III (EC 3.1.11.2)
 
CRON 3.
malE
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -139
score = 5.95672
sequence = TTTCGCAATCGTTTGCGAAA

Gene: Cbei_0230: Maltose/maltodextrin ABC transporter, substrate-binding component
 
Clostridium botulinum A str. ATCC 3502
*
Clostridium butyricum 5521

Site:
position = -108
score = 6.46562
sequence = TTTTGCAAGCGATTGCATAT

Gene: CBY_2940: Maltose/maltodextrin ABC transporter, substrate-binding component
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Maltose/maltodextrin ABC transporter, substrate-binding component
malF
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0231: Maltose/maltodextrin ABC transporter, permease protein 1
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_2941: Maltose/maltodextrin ABC transporter, permease protein 1
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Maltose/maltodextrin ABC transporter, permease protein 1
malG
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0232: Maltose/maltodextrin ABC transporter, permease protein 2
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_2942: Maltose/maltodextrin ABC transporter, permease protein 2
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Maltose/maltodextrin ABC transporter, permease protein 2
 
CRON 4.
malM
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -89
score = 6.40505
sequence = TTGCGCAAGCGATTGCTTTA

Gene: Cbei_0233: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Clostridium botulinum A str. ATCC 3502
*
Clostridium butyricum 5521

Site:
position = -55
score = 6.25335
sequence = TTATGCAAGCGATTGCTTAG

Gene: CBY_2943: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
CRON 5.
amyB
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -154
score = 5.64224
sequence = TTGTGCAAACGATTTCACTA

Gene: CBO1203: Beta-amylase precursor (EC 3.2.1.2)
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Beta-amylase precursor (EC 3.2.1.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD