Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia cepacia AMMD
Burkholderia glumae BGR1
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815 6 1
Burkholderia pseudomallei K96243
Burkholderia sp. 383
Burkholderia vietnamiensis G4
Burkholderia xenovorans LB400 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglB
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
*
Burkholderia phymatum STM815

Site:
position = -86
score = 7.14561
sequence = ATGTGGAAGCGCTTCCACTC

Gene: Bphy_5434: Beta-glucosidase (EC 3.2.1.21)
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
*
Burkholderia xenovorans LB400

Site:
position = -172
score = 7.14561
sequence = GTGTGGAAGCGCTTCCACTT

Gene: Bxe_B2084: Beta-glucosidase (EC 3.2.1.21)
Beta-glucosidase (EC 3.2.1.21)
bglE
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_5435: Beta-glucosides specific ABC transporter, substrate-binding protein
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_B2083: Beta-glucosides specific ABC transporter, substrate-binding protein
Beta-glucosides specific ABC transporter, substrate-binding protein
bglF
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_5436: Beta-glucosides specific ABC transporter, permease protein 1
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_B2082: Beta-glucosides specific ABC transporter, permease protein 1
Beta-glucosides specific ABC transporter, permease protein 1
bglG
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_5437: Beta-glucosides specific ABC transporter, permease protein 2
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_B2081: Beta-glucosides specific ABC transporter, permease protein 2
Beta-glucosides specific ABC transporter, permease protein 2
bglK
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_5438: Beta-glucosides specific ABC transporter, ATP-binding protein
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_B2080: Beta-glucosides specific ABC transporter, ATP-binding protein
Beta-glucosides specific ABC transporter, ATP-binding protein
bglR
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_5439: Beta-glucosides utilization transcriptional regulator BglR, LacI family
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_B2079: Beta-glucosides utilization transcriptional regulator BglR, LacI family
Beta-glucosides utilization transcriptional regulator BglR, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD