Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Bamb_4155 - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia cepacia AMMD 3 1
Burkholderia glumae BGR1
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815
Burkholderia pseudomallei K96243
Burkholderia sp. 383 3 1
Burkholderia vietnamiensis G4 3 1
Burkholderia xenovorans LB400
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Bamb_4158
*
Burkholderia cepacia AMMD

Site:
position = 43
score = 7.46874
sequence = CGTTGCACACGTGTGCAACG

Gene: Bamb_4158: Sugar ABC transporter, substrate-binding protein
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = 192
score = 7.46874
sequence = CGTTGCACACGTGTGCAACG

Gene: Bcep18194_B0939: Sugar ABC transporter, substrate-binding protein
*
Burkholderia vietnamiensis G4

Site:
position = -59
score = 7.1044
sequence = CGCTGCACACGTGTGCAGTG

Gene: Bcep1808_5293: Sugar ABC transporter, substrate-binding protein
 
Burkholderia xenovorans LB400
Sugar ABC transporter, substrate-binding protein
Bamb_4157
 
Burkholderia cepacia AMMD

Gene: Bamb_4157: Sugar ABC transporter, permease protein 2
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_B0940: Sugar ABC transporter, permease protein 2
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5292: Sugar ABC transporter, permease protein 2
 
Burkholderia xenovorans LB400
Sugar ABC transporter, permease protein 2
Bamb_4156
 
Burkholderia cepacia AMMD

Gene: Bamb_4156: Sugar ABC sugar transporter, inner membrane subunit
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_B0941: Sugar ABC sugar transporter, inner membrane subunit
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5291: Sugar ABC sugar transporter, inner membrane subunit
 
Burkholderia xenovorans LB400
Sugar ABC sugar transporter, inner membrane subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD