Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GalR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Actinobacillus succinogenes 130Z
Aggregatibacter aphrophilus NJ8700 7 3
Haemophilus ducreyi 35000HP
Haemophilus influenzae Rd KW20 7 3
Haemophilus parasuis SH0165
Haemophilus somnus 2336 6 2
Mannheimia succiniciproducens MBEL55E 8 3
Pasteurella multocida subsp. multocida str. Pm70 7 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
galR
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -224
score = 5.68734
sequence = TTATGAAAACGATTACAAAA

Site:
position = -76
score = 5.21674
sequence = AAAAGTAAGCGTTTTCAAAT

Gene: NT05HA_1260: Transcriptional regulator for galactose utilization, LacI family
 
Haemophilus ducreyi 35000HP
*
Haemophilus influenzae Rd KW20

Site:
position = -188
score = 5.86159
sequence = CAATGTAAACGATTACATTA

Gene: HI0821: Transcriptional regulator for galactose utilization, LacI family
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -222
score = 5.77979
sequence = TATTGAAAACGGTTACATTT

Site:
position = -91
score = 5.65188
sequence = AAAAGTAACCGTTTTCAATA

Gene: MS0644: Transcriptional regulator for galactose utilization, LacI family
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -209
score = 5.59158
sequence = AACTGAAAACGGTTACATTT

Gene: PM1037: Transcriptional regulator for galactose utilization, LacI family
Transcriptional regulator for galactose utilization, LacI family
 
CRON 2.
galT
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -49
score = 6.30098
sequence = TTTTGTAATCGTTTTCATAA

Gene: NT05HA_1259: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
 
Haemophilus ducreyi 35000HP
*
Haemophilus influenzae Rd KW20

Site:
position = -39
score = 6.21628
sequence = TAATGTAATCGTTTACATTG

Gene: HI0820: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
 
Haemophilus parasuis SH0165
*
Haemophilus somnus 2336

Site:
position = -52
score = 6.27354
sequence = ATTTGTAATCGTTTACATTT

Gene: HSM_0108: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
*2
Mannheimia succiniciproducens MBEL55E

Site:
position = -100
score = 6.23377
sequence = AAATGTAACCGTTTTCAATA

Gene: MS0646: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)

Gene: MS0647: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -34
score = 6.04218
sequence = AAATGTAACCGTTTTCAGTT

Gene: PM1036: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
galK
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1258: Galactokinase (EC 2.7.1.6)
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20

Gene: HI0819: Galactokinase (EC 2.7.1.6)
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336

Gene: HSM_0109: Galactokinase (EC 2.7.1.6)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0648: Galactokinase (EC 2.7.1.6)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1035: Galactokinase (EC 2.7.1.6)
Galactokinase (EC 2.7.1.6)
galM
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1257: Aldose 1-epimerase (EC 5.1.3.3)
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20

Gene: HI0818: Aldose 1-epimerase (EC 5.1.3.3)
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336

Gene: HSM_0110: Aldose 1-epimerase (EC 5.1.3.3)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0649: Aldose 1-epimerase (EC 5.1.3.3)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1034: Aldose 1-epimerase (EC 5.1.3.3)
Aldose 1-epimerase (EC 5.1.3.3)
 
CRON 3.
mglB
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1513: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1898: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -187
score = 6.19678
sequence = AGATGTAATCGTTTTCATAA

Gene: NT05HA_1261: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
 
Haemophilus ducreyi 35000HP
*
Haemophilus influenzae Rd KW20

Site:
position = -113
score = 6.07554
sequence = TTATGTAATCATTTTCATTT

Gene: HI0822: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
 
Haemophilus parasuis SH0165

Gene: HAPS_0442: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
*
Haemophilus somnus 2336

Site:
position = -148
score = 6.28501
sequence = TTATGAAATCGTTTTCATAA

Gene: HSM_0105: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -161
score = 5.87085
sequence = TTATGTAATCGTTTCCACAT

Gene: MS0643: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -142
score = 6.11589
sequence = AATTGTAATCGTTTTCACAA

Gene: PM1038: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
mglA
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1514: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1897: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1262: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20

Gene: HI0823: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Haemophilus parasuis SH0165

Gene: HAPS_0443: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Haemophilus somnus 2336

Gene: HSM_0104: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0642: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1039: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
mglC
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1515: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1896: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1263: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20

Gene: HI0824: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
 
Haemophilus parasuis SH0165

Gene: HAPS_0444: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
 
Haemophilus somnus 2336

Gene: HSM_0103: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0641: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1040: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD