Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HpxR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Xanthine utilization
Effector: Xanthine
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cupriavidus taiwanensis 3 1
Ralstonia eutropha H16 3 1
Ralstonia eutropha JMP134 3 1
Ralstonia metallidurans CH34
Ralstonia pickettii 12J
Ralstonia solanacearum GMI1000
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
uraA
*
Cupriavidus taiwanensis

Site:
position = -203
score = 6.92778
sequence = TTACCAAAACGTTTTTGTTA

Gene: RALTA_B0719: Xanthine/uracil permease
*
Ralstonia eutropha H16

Site:
position = -119
score = 6.66994
sequence = TTACCAAAACGTTTTTGTTT

Gene: H16_B0861: Xanthine/uracil permease
*
Ralstonia eutropha JMP134

Site:
position = -119
score = 6.90087
sequence = TAACCAAAACGTTTTGGCTA

Gene: Reut_B4531: Xanthine/uracil permease
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Xanthine/uracil permease
COG0402
 
Cupriavidus taiwanensis

Gene: RALTA_B0720: Cytosine deaminase and related metal-dependent hydrolases
 
Ralstonia eutropha H16

Gene: H16_B0862: Cytosine deaminase and related metal-dependent hydrolases
 
Ralstonia eutropha JMP134

Gene: Reut_B4530: Cytosine deaminase and related metal-dependent hydrolases
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Cytosine deaminase and related metal-dependent hydrolases
PF01925
 
Cupriavidus taiwanensis

Gene: RALTA_B0721: Protein of unknown function DUF81
 
Ralstonia eutropha H16

Gene: H16_B0863: Protein of unknown function DUF81
 
Ralstonia eutropha JMP134

Gene: Reut_B4529: Protein of unknown function DUF81
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Protein of unknown function DUF81
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD