Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GalR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 30 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9 8 3
Vibrio angustum S14 4 1
Vibrio cholerae O1 biovar eltor str. N16961 5 3
Vibrio fischeri ES114 5 2
Vibrio harveyi ATCC BAA-1116 2 2
Vibrio parahaemolyticus RIMD 2210633 5 2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1 14 5
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6 11 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lacE
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -58
score = 5.57492
sequence = CTGTGTAAACGTTTCCAAAT

Site:
position = -223
score = 4.74864
sequence = AATTGTTAACGTATCCAAAT

Gene: VSAK1_10773: Probable lactose uptake ABC transporter, periplasmic solute-binding protein
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Probable lactose uptake ABC transporter, periplasmic solute-binding protein
lacF
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10768: Probable lactose uptake ABC transporter, permease protein 1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Probable lactose uptake ABC transporter, permease protein 1
lacG
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10763: Probable lactose uptake ABC transporter, permease protein 2
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Probable lactose uptake ABC transporter, permease protein 2
lacZ
 
Photobacterium profundum SS9

Gene: PBPRB0034: Beta-galactosidase (EC 3.2.1.23)
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10758: Beta-galactosidase (EC 3.2.1.23)
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV2_1327: Beta-galactosidase (EC 3.2.1.23)
Beta-galactosidase (EC 3.2.1.23)
lacK
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10753: Probable lactose uptake ABC transporter, ATP-binding protein
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Probable lactose uptake ABC transporter, ATP-binding protein
lacP
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -96
score = 5.19872
sequence = TCATGAAAACGTTTCCATAG

Gene: VV21329: predicted lactoporin
predicted lactoporin
VV21328
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV21328: lactose operon periplasmic protein
lactose operon periplasmic protein
 
CRON 2.
mglB
*
Photobacterium profundum SS9

Site:
position = -154
score = 5.02059
sequence = TTGGGGGAACGTTTACATTA

Gene: PBPRB1872: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -107
score = 5.37786
sequence = CTGAGTAAACGTTTTCACTG

Gene: VC1325: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -327
score = 5.45014
sequence = TATTGTAAACGTTCTCATAA

Site:
position = -97
score = 4.74535
sequence = TGGGTTAAACGTTTTCACTT

Gene: VSAK1_10743: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -90
score = 5.33382
sequence = AAGGGTAAACGTTTTCACCA

Gene: VV21326: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
mglA
 
Photobacterium profundum SS9

Gene: PBPRB1871: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1327: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10738: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV21325: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
mglC
 
Photobacterium profundum SS9

Gene: PBPRB1870: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1328: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10733: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV21324: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
 
CRON 3.
VV21682
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -119
score = 4.79423
sequence = AAATGCAATCGATTACACAT

Gene: VV21682: Chitinase, putative
Chitinase, putative
 
CRON 4.
galR
*
Photobacterium profundum SS9

Site:
position = -152
score = 5.00608
sequence = TACTGATAACGATTACAAAA

Gene: PBPRA2078: Transcriptional regulator for galactose and lactose utilization, LacI family
 
Vibrio angustum S14

Gene: VAS14_15144: Transcriptional regulator for galactose and lactose utilization, LacI family
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -139
score = 5.45537
sequence = CATTAAAAACGTTTACACTT

Gene: VC2337: Transcriptional regulator for galactose and lactose utilization, LacI family
*
Vibrio fischeri ES114

Site:
position = -107
score = 5.72277
sequence = TAATGATAACGTTTACAAAA

Gene: VF_A0361: Transcriptional regulator for galactose and lactose utilization, LacI family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -149
score = 4.66013
sequence = CTAAGATAACGTTTATACAT

Gene: VIBHAR_03325: Transcriptional regulator for galactose and lactose utilization, LacI family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -149
score = 5.57747
sequence = AAAAGATAACGTTTACACTA

Gene: VP2393: Transcriptional regulator for galactose and lactose utilization, LacI family
 
Vibrio salmonicida LFI1238
*2
Vibrio shilonii AK1

Gene: VSAK1_10693: Transcriptional regulator for galactose and lactose utilization, LacI family

Site:
position = -115
score = 5.22353
sequence = TTTTGGAAACGATTACTCTA

Site:
position = -245
score = 5.60066
sequence = TCATGGAAACGTTTACAATT

Gene: VSAK1_00922: Transcriptional regulator for galactose and lactose utilization, LacI family
 
Vibrio splendidus LGP32
*2
Vibrio vulnificus CMCP6

Gene: VV21323: Transcriptional regulator for galactose and lactose utilization, LacI family

Site:
position = -139
score = 5.57747
sequence = AAAAGATAACGTTTACACTA

Gene: VV1_1775: Transcriptional regulator for galactose and lactose utilization, LacI family
Transcriptional regulator for galactose and lactose utilization, LacI family
 
CRON 5.
galE
*
Photobacterium profundum SS9

Site:
position = -105
score = 6.01452
sequence = TCGTGGAAACGTTTACACAA

Gene: PBPRA2082: UDP-glucose 4-epimerase (EC 5.1.3.2)
*
Vibrio angustum S14

Site:
position = -131
score = 6.35725
sequence = AAATGTAAACGTTTACACAA

Gene: VAS14_15124: UDP-glucose 4-epimerase (EC 5.1.3.2)
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio fischeri ES114

Site:
position = -247
score = 5.57794
sequence = GATTGTAAACGTTTACAATT

Site:
position = -92
score = 6.44958
sequence = TAGTGTAAACGTTTACATTT

Gene: VF_A0352: UDP-glucose 4-epimerase (EC 5.1.3.2)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -254
score = 6.0236
sequence = TTGTGTAAACGTTTATACAT

Site:
position = -153
score = 5.41258
sequence = TTGTGGAAACGTTTGCTCTA

Gene: VIBHAR_03331: UDP-glucose 4-epimerase (EC 5.1.3.2)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -170
score = 6.25464
sequence = TTGTGGAAACGTTTACACAA

Gene: VP2400: UDP-glucose 4-epimerase (EC 5.1.3.2)
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -238
score = 4.71204
sequence = TTGTGTAATCGTTTAACTTT

Site:
position = -140
score = 6.6085
sequence = TAGTGTAAACGTTTACACTT

Gene: VSAK1_10728: UDP-glucose 4-epimerase (EC 5.1.3.2)
 
Vibrio splendidus LGP32
*2
Vibrio vulnificus CMCP6

Site:
position = -125
score = 6.44298
sequence = TAGTGAAAACGTTTACACTT

Gene: VV1_1770: UDP-glucose 4-epimerase (EC 5.1.3.2)

Gene: VV21095: UDP-glucose 4-epimerase (EC 5.1.3.2)
UDP-glucose 4-epimerase (EC 5.1.3.2)
galT
 
Photobacterium profundum SS9

Gene: PBPRA2081: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
 
Vibrio angustum S14

Gene: VAS14_15129: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -162
score = 5.64227
sequence = TTGTGAAAGCGTTTACACTG

Gene: VC1596: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
 
Vibrio fischeri ES114

Gene: VF_A0353: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03329: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2399: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10723: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
 
Vibrio splendidus LGP32
 2
Vibrio vulnificus CMCP6

Gene: VV1_1771: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)

Gene: VV21094: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
galK
 
Photobacterium profundum SS9

Gene: PBPRA2080: Galactokinase (EC 2.7.1.6)
 
Vibrio angustum S14

Gene: VAS14_15134: Galactokinase (EC 2.7.1.6)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1595: Galactokinase (EC 2.7.1.6)
 
Vibrio fischeri ES114

Gene: VF_A0355: Galactokinase (EC 2.7.1.6)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03327: Galactokinase (EC 2.7.1.6)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2398: Galactokinase (EC 2.7.1.6)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10718: Galactokinase (EC 2.7.1.6)
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1772: Galactokinase (EC 2.7.1.6)
Galactokinase (EC 2.7.1.6)
galM
 
Photobacterium profundum SS9

Gene: PBPRA2079: Aldose 1-epimerase (EC 5.1.3.3)
 
Vibrio angustum S14

Gene: VAS14_15139: Aldose 1-epimerase (EC 5.1.3.3)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1594: Aldose 1-epimerase (EC 5.1.3.3)
 
Vibrio fischeri ES114

Gene: VF_A0356: Aldose 1-epimerase (EC 5.1.3.3)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03326: Aldose 1-epimerase (EC 5.1.3.3)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2397: Aldose 1-epimerase (EC 5.1.3.3)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_10713: Aldose 1-epimerase (EC 5.1.3.3)
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1773: Aldose 1-epimerase (EC 5.1.3.3)
Aldose 1-epimerase (EC 5.1.3.3)
 
CRON 6.
galW
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -103
score = 5.60717
sequence = CAGTGTAAACGTTTCCAGTT

Gene: VSAK1_00937: Predicted Na+/alpha-galactoside symporter
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -148
score = 5.16768
sequence = GTCTGTAAACGTTTCCATAA

Gene: VV21332: Predicted Na+/alpha-galactoside symporter
Predicted Na+/alpha-galactoside symporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD