Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Aeromonas hydrophila subsp. hydrophila ATCC 7966 5 2
Aeromonas salmonicida subsp. salmonicida A449 5 2
Tolumonas auensis DSM 9187 3 1
Moritella sp. PE36
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrY
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -108
score = 6.50968
sequence = CAGCTGAAACGGTTTAGCTG

Site:
position = -77
score = 6.22118
sequence = TAGCTAAATTGGTTTAGCTA

Gene: AHA_2981: Sucrose-specific outer membrane porin
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -109
score = 5.70573
sequence = TGGCTGAAAGGGTTTAGCTG

Site:
position = -78
score = 6.97676
sequence = TAGCTAAAACGGTTTAGCTA

Gene: ASA_2994: Sucrose-specific outer membrane porin
 
Tolumonas auensis DSM 9187
 
Moritella sp. PE36
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
Sucrose-specific outer membrane porin
 
CRON 2.
scrK
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -66
score = 6.59612
sequence = TGGCTAAAACGGTTTAGCTG

Gene: AHA_2980: Fructokinase (EC 2.7.1.4)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -108
score = 6.71088
sequence = TAGCTAAATCGGTTTAGCTG

Gene: ASA_2993: Fructokinase (EC 2.7.1.4)
 
Tolumonas auensis DSM 9187

Gene: Tola_1011: Fructokinase (EC 2.7.1.4)
 
Moritella sp. PE36
 
Psychromonas ingrahamii 37

Gene: Ping_0971: Fructokinase (EC 2.7.1.4)
 
Psychromonas sp. CNPT3
Fructokinase (EC 2.7.1.4)
scrA
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2979: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2992: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
*
Tolumonas auensis DSM 9187

Site:
position = -330
score = 6.14449
sequence = TTGCTAAAACGGTTTAGCGA

Site:
position = -299
score = 6.32822
sequence = TAGCTAAACCGTTTTAGTAA

Gene: Tola_0815: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
 
Moritella sp. PE36
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
scrB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2978: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2991: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Tolumonas auensis DSM 9187

Gene: Tola_0814: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Moritella sp. PE36
 
Psychromonas ingrahamii 37

Gene: Ping_0974: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Psychromonas sp. CNPT3
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrR
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2977: Sucrose operon repressor ScrR, LacI family
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2990: Sucrose operon repressor ScrR, LacI family
 
Tolumonas auensis DSM 9187

Gene: Tola_0813: Sucrose operon repressor ScrR, LacI family
 
Moritella sp. PE36
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
Sucrose operon repressor ScrR, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD