Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 35 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alteromonadales bacterium TW-7 14 6
Alteromonas macleodii 'Deep ecotype' 5 2
Colwellia psychrerythraea 34H 12 4
Glaciecola sp. HTCC2999 10 4
Idiomarina baltica OS145 7 3
Idiomarina loihiensis L2TR
Pseudoalteromonas atlantica T6c
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2 7 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lamA
*
Alteromonadales bacterium TW-7

Site:
position = -92
score = 6.14378
sequence = AAATGTAAGCGCTTACAGAA

Site:
position = -120
score = 6.45193
sequence = ATTTGTAAGCGCTTACAATT

Gene: ATW7_02192: Beta-glucanase precursor (EC 3.2.1.73)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03791: Beta-glucanase precursor (EC 3.2.1.73)
 
Colwellia psychrerythraea 34H
*
Glaciecola sp. HTCC2999

Site:
position = -110
score = 5.94706
sequence = CTGTGGAAGCGCTTACATTT

Site:
position = -68
score = 6.235
sequence = AGATGTAAGCGCTTACATCA

Gene: GHTCC_010100001564: Beta-glucanase precursor (EC 3.2.1.73)
*
Idiomarina baltica OS145

Site:
position = -64
score = 6.39654
sequence = TTGTGAAAGCGCTTACATTT

Gene: OS145_00595: Beta-glucanase precursor (EC 3.2.1.73)
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -91
score = 6.32222
sequence = AAATGGAAGCGCTTACATAA

Site:
position = -132
score = 6.40119
sequence = TTATGAAAGCGCTTACATTC

Gene: PTD2_20417: Beta-glucanase precursor (EC 3.2.1.73)
Beta-glucanase precursor (EC 3.2.1.73)
omp(Bgl)2
 
Alteromonadales bacterium TW-7

Gene: ATW7_02187: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
 2
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03790: Predicted beta-glucoside specific TonB-dependent outer membrane receptor

Gene: MADE_03792: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100001569: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
 
Idiomarina baltica OS145

Gene: OS145_00600: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_20412: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
Predicted beta-glucoside specific TonB-dependent outer membrane receptor
 
CRON 2.
omp(Bgl)1
*
Alteromonadales bacterium TW-7

Site:
position = -100
score = 4.71716
sequence = TTCTGGAAGCGCTTCCACAC

Site:
position = -140
score = 4.98484
sequence = TTCTGGAAGCGCTTCCACAT

Gene: ATW7_07974: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
 
Alteromonas macleodii 'Deep ecotype'
*
Colwellia psychrerythraea 34H

Site:
position = -165
score = 6.20506
sequence = TTATGTAAGCGCTTACACCA

Site:
position = -449
score = 6.52281
sequence = AAATGTAAGCGCTTACAAAT

Site:
position = -240
score = 6.76645
sequence = TTATGTAAGCGCTTACATTT

Gene: CPS_3698: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3278: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Predicted beta-glucoside specific TonB-dependent outer membrane receptor
trpH1
 
Alteromonadales bacterium TW-7

Gene: ATW7_07979: putative tryptophan halogenase
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_3699: putative tryptophan halogenase
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
putative tryptophan halogenase
trpH2
 
Alteromonadales bacterium TW-7

Gene: ATW7_07984: putative tryptophan halogenase
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_3700: putative tryptophan halogenase
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3277: putative tryptophan halogenase
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
putative tryptophan halogenase
 
CRON 3.
glcP
*
Alteromonadales bacterium TW-7

Site:
position = -132
score = 6.19035
sequence = CTGTGAAAGCGCTTACATTT

Gene: ATW7_07849: Predicted glucose transporter in beta-glucoside utilization gene cluster
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -64
score = 6.07976
sequence = AGATGTAAGCGCTTTCAAAT

Site:
position = -96
score = 6.60477
sequence = TTATGTAAGCGCTTACAAAA

Gene: MADE_03795: Predicted glucose transporter in beta-glucoside utilization gene cluster
*
Colwellia psychrerythraea 34H

Site:
position = -271
score = 6.19164
sequence = TTATGTGAGCGCTTACAAAA

Site:
position = -216
score = 5.98801
sequence = GGATGTAAGCGCTTACATTT

Gene: CPS_3705: Predicted glucose transporter in beta-glucoside utilization gene cluster
*
Glaciecola sp. HTCC2999

Site:
position = -72
score = 6.18095
sequence = CAATGAAAGCGCTTTCATTT

Gene: GHTCC_010100001604: Predicted glucose transporter in beta-glucoside utilization gene cluster
*
Idiomarina baltica OS145

Site:
position = -69
score = 6.32222
sequence = ACATGAAAGCGCTTACATAA

Gene: OS145_00610: Predicted glucose transporter in beta-glucoside utilization gene cluster
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -124
score = 6.39654
sequence = ATGTGAAAGCGCTTACATTT

Site:
position = -183
score = 6.45193
sequence = TTTTGTAAGCGCTTACAATT

Gene: PTD2_03951: Predicted glucose transporter in beta-glucoside utilization gene cluster
Predicted glucose transporter in beta-glucoside utilization gene cluster
bglA2
*2
Alteromonadales bacterium TW-7

Site:
position = -173
score = 5.35986
sequence = AGTTGGAAGCGCTTCCATAA

Gene: ATW7_07989: Periplasmic beta-glucosidase (EC 3.2.1.21)

Gene: ATW7_07844: Periplasmic beta-glucosidase (EC 3.2.1.21)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03794: Periplasmic beta-glucosidase (EC 3.2.1.21)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100001599: Periplasmic beta-glucosidase (EC 3.2.1.21)
 
Idiomarina baltica OS145

Gene: OS145_00605: Periplasmic beta-glucosidase (EC 3.2.1.21)
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03946: Periplasmic beta-glucosidase (EC 3.2.1.21)
Periplasmic beta-glucosidase (EC 3.2.1.21)
lamA
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100001594: Predicted glucose transporter in beta-glucoside utilization gene cluster
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Predicted glucose transporter in beta-glucoside utilization gene cluster
 
CRON 4.
bglA1
*2
Alteromonadales bacterium TW-7

Site:
position = -129
score = 4.75321
sequence = ATATGGAAGCGCTTCCTGAA

Site:
position = -71
score = 5.53425
sequence = TTATGGAAGCGCTTCCAACT

Gene: ATW7_07994: Cytoplasmic beta-glucosidase (EC 3.2.1.21)

Site:
position = -146
score = 5.97921
sequence = AAATGTAAGCGCTTTCACAG

Gene: ATW7_07854: Cytoplasmic beta-glucosidase (EC 3.2.1.21)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -130
score = 6.57084
sequence = TTTTGTAAGCGCTTACATAA

Site:
position = -162
score = 6.28845
sequence = ATTTGAAAGCGCTTACATCT

Gene: MADE_03797: Cytoplasmic beta-glucosidase (EC 3.2.1.21)
*
Colwellia psychrerythraea 34H

Site:
position = -126
score = 6.21061
sequence = AAATGTAAGCGCTTACATCC

Site:
position = -71
score = 5.98401
sequence = TTTTGTAAGCGCTCACATAA

Gene: CPS_3706: Cytoplasmic beta-glucosidase (EC 3.2.1.21)
*
Glaciecola sp. HTCC2999

Site:
position = -103
score = 6.25821
sequence = AAATGAAAGCGCTTTCATTG

Gene: GHTCC_010100001609: Cytoplasmic beta-glucosidase (EC 3.2.1.21)
*
Idiomarina baltica OS145

Site:
position = -73
score = 6.27763
sequence = TTATGTAAGCGCTTTCATGT

Gene: OS145_00615: Cytoplasmic beta-glucosidase (EC 3.2.1.21)
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -52
score = 6.34858
sequence = AATTGTAAGCGCTTACAAAA

Site:
position = -111
score = 6.10814
sequence = AAATGTAAGCGCTTTCACAT

Gene: PTD2_03956: Cytoplasmic beta-glucosidase (EC 3.2.1.21)
Cytoplasmic beta-glucosidase (EC 3.2.1.21)
bglT2
 
Alteromonadales bacterium TW-7

Gene: ATW7_07999: Predicted beta-glucoside transporter, MFS family
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_3707: Predicted beta-glucoside transporter, MFS family
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3275: Predicted beta-glucoside transporter, MFS family
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Predicted beta-glucoside transporter, MFS family
bglT
 
Alteromonadales bacterium TW-7

Gene: ATW7_07859: Predicted beta-glucoside transporter, GPH family
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_3708: Predicted beta-glucoside transporter, GPH family
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145

Gene: OS145_00620: Predicted beta-glucoside transporter, GPH family
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03961: Predicted beta-glucoside transporter, GPH family
Predicted beta-glucoside transporter, GPH family
bglR
 2
Alteromonadales bacterium TW-7

Gene: ATW7_08004: Transcriptional regulator of beta-glucosides utilization, LacI family

Gene: ATW7_07864: Transcriptional regulator of beta-glucosides utilization, LacI family
 2
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03798: Transcriptional regulator of beta-glucosides utilization, LacI family

Gene: MADE_04075: Transcriptional regulator of beta-glucosides utilization, LacI family
 
Colwellia psychrerythraea 34H

Gene: CPS_3709: Transcriptional regulator of beta-glucosides utilization, LacI family
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100001614: Transcriptional regulator of beta-glucosides utilization, LacI family
 
Idiomarina baltica OS145

Gene: OS145_00625: Transcriptional regulator of beta-glucosides utilization, LacI family
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03966: Transcriptional regulator of beta-glucosides utilization, LacI family
Transcriptional regulator of beta-glucosides utilization, LacI family
glk
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_3710: Glucokinase, ROK family (EC 2.7.1.2)
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Glucokinase, ROK family (EC 2.7.1.2)
bglT3
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03799: Predicted beta-glucoside transporter, MFS family
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100001619: Predicted beta-glucoside transporter, MFS family
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Predicted beta-glucoside transporter, MFS family
GHTCC_010100001624
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100001624: TonB-dependent receptor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
TonB-dependent receptor
 
CRON 5.
GHTCC_010100003724
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
*
Glaciecola sp. HTCC2999

Site:
position = -99
score = 6.68448
sequence = AAATGTAAGCGCTTACATTT

Gene: GHTCC_010100003724: Endo-1,3(4)-beta-glucanase
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Endo-1,3(4)-beta-glucanase
 
CRON 6.
CPS_3697
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
*
Colwellia psychrerythraea 34H

Site:
position = -108
score = 6.59222
sequence = ATTTGTAAGCGCTTACATTT

Gene: CPS_3697: Predicted beta-glucoside transporter, GPH family
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Predicted beta-glucoside transporter, GPH family
celP
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_3696: Cellobiose phosphorylase
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Cellobiose phosphorylase
gntK
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_3695: Gluconokinase (EC 2.7.1.12)
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Gluconokinase (EC 2.7.1.12)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD