Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR2 - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a 5 2
Xanthomonas axonopodis pv. citri str. 306 5 2
Xanthomonas campestris pv. campestris str. ATCC 33913 5 2
Xylella fastidiosa 9a5c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruB
*
Stenotrophomonas maltophilia K279a

Site:
position = 3
score = 6.44401
sequence = CAGTGGGAACGTTCCCAATA

Site:
position = -106
score = 5.88552
sequence = CATTGGAAACGTTCCCGGAA

Gene: Smlt2556: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -164
score = 5.20892
sequence = CACTGGGACCGTTCCCGCTC

Site:
position = -53
score = 6.95441
sequence = TCGTGGGAACGTTCCCACTA

Gene: XAC2501: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -165
score = 5.20892
sequence = CACTGGGACCGTTCCCGCTC

Site:
position = -55
score = 6.83785
sequence = CCGTGGGAACGTTCCCACTA

Gene: XCC2370: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Xylella fastidiosa 9a5c
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
fruK
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2557: 1-phosphofructokinase (EC 2.7.1.56)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2502: 1-phosphofructokinase (EC 2.7.1.56)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2371: 1-phosphofructokinase (EC 2.7.1.56)
 
Xylella fastidiosa 9a5c
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2558: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2503: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2372: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Xylella fastidiosa 9a5c
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
fruO
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2559: Predicted fructose-specific outer membrane porin
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2504: Predicted fructose-specific outer membrane porin
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2373: Predicted fructose-specific outer membrane porin
 
Xylella fastidiosa 9a5c
Predicted fructose-specific outer membrane porin
 
CRON 2.
fruR2
*
Stenotrophomonas maltophilia K279a

Site:
position = -126
score = 6.83785
sequence = TATTGGGAACGTTCCCACTG

Gene: Smlt2555: Transcriptional regulator for fructose utilization, LacI family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -17
score = 5.13716
sequence = GAGCGGGAACGGTCCCAGTG

Site:
position = -128
score = 7.0039
sequence = TAGTGGGAACGTTCCCACGA

Gene: XAC2500: Transcriptional regulator for fructose utilization, LacI family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -127
score = 6.88734
sequence = TAGTGGGAACGTTCCCACGG

Site:
position = -17
score = 5.13716
sequence = GAGCGGGAACGGTCCCAGTG

Gene: XCC2369: Transcriptional regulator for fructose utilization, LacI family
 
Xylella fastidiosa 9a5c
Transcriptional regulator for fructose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD