Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR2 - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anaerocellum thermophilum DSM 6725 6 2
Caldicellulosiruptor saccharolyticus DSM 8903 6 2
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514 6 3
Thermoanaerobacter italicus Ab9 6 3
Thermoanaerobacter tengcongensis MB4 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
TTE1813
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514
 
Thermoanaerobacter italicus Ab9
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -40
score = 5.24675
sequence = TATAACAAACGTTTGCACAA

Gene: TTE1813: Glucoamylase (EC 3.2.1.3)
Glucoamylase (EC 3.2.1.3)
 
CRON 2.
glgB
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -96
score = 4.94036
sequence = TTATGAAAGCGATTGCCTAA

Site:
position = -154
score = 5.64174
sequence = TTGCGCAAAAATTTGCACAA

Gene: Teth514_1781: Alpha amylase, catalytic region
*
Thermoanaerobacter italicus Ab9

Site:
position = -153
score = 5.01998
sequence = TTGCGCAAAAAATTGCACAG

Site:
position = -96
score = 5.47766
sequence = TTGTGAAAGCGATTGCTTAA

Gene: Thit_0062: Alpha amylase, catalytic region
 
Thermoanaerobacter tengcongensis MB4
Alpha amylase, catalytic region
 
CRON 3.
malF
*
Anaerocellum thermophilum DSM 6725

Site:
position = -45
score = 5.84221
sequence = AAGAGCAAACGATTGCACAT

Gene: Athe_2578: Maltose/maltodextrin ABC transporter, permease protein 1
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -46
score = 5.63904
sequence = AAGAGCAAACGATTGCACAC

Gene: Csac_0427: Maltose/maltodextrin ABC transporter, permease protein 1
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1182: Maltose/maltodextrin ABC transporter, permease protein 1
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1642: Maltose/maltodextrin ABC transporter, permease protein 1
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1830: Maltose/maltodextrin ABC transporter, permease protein 1
Maltose/maltodextrin ABC transporter, permease protein 1
malG
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_2577: Maltose/maltodextrin ABC transporter, permease protein 2
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0428: Maltose/maltodextrin ABC transporter, permease protein 2
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1183: Maltose/maltodextrin ABC transporter, permease protein 2
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1641: Maltose/maltodextrin ABC transporter, permease protein 2
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1829: Maltose/maltodextrin ABC transporter, permease protein 2
Maltose/maltodextrin ABC transporter, permease protein 2
glgP1
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_2576: Glycogen phosphorylase (EC 2.4.1.1)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0429: Glycogen phosphorylase (EC 2.4.1.1)
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4
Glycogen phosphorylase (EC 2.4.1.1)
malR2
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_2575: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0430: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0582: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
 
Thermoanaerobacter italicus Ab9

Gene: Thit_2246: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2576: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
malE
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_2574: Maltose/maltodextrin ABC transporter, substrate binding protein
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0431: Maltose/maltodextrin ABC transporter, substrate binding protein
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1181: Maltose/maltodextrin ABC transporter, substrate binding protein
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1643: Maltose/maltodextrin ABC transporter, substrate binding protein
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1831: Maltose/maltodextrin ABC transporter, substrate binding protein
Maltose/maltodextrin ABC transporter, substrate binding protein
amyA
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -230
score = 5.52034
sequence = ATGAGCAAAAGCTTGCAGAA

Gene: Teth514_1180: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
*
Thermoanaerobacter italicus Ab9

Site:
position = -228
score = 5.52034
sequence = ATGAGCAAAAGCTTGCAGAA

Site:
position = -106
score = 4.92662
sequence = AAGCGCAAGCGATTGCAAGA

Gene: Thit_1644: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -229
score = 4.98304
sequence = ATGAGCAAAAGCTTGCAGAG

Site:
position = -107
score = 5.46392
sequence = TAGCGCAAGCGATTGCAATA

Gene: TTE1832: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
 
CRON 4.
amyB
*
Anaerocellum thermophilum DSM 6725

Site:
position = -91
score = 5.83288
sequence = TTATGCAAACATTTGCATTA

Gene: Athe_2579: Neopullulanase (EC 3.2.1.135)
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -93
score = 5.83288
sequence = TTATGCAAACATTTGCATTA

Gene: Csac_0426: Neopullulanase (EC 3.2.1.135)
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4
Neopullulanase (EC 3.2.1.135)
 
CRON 5.
glgP2
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -74
score = 6.17914
sequence = TTGTGCAAACACTTGCATAA

Gene: Teth514_1209: Glycogen phosphorylase (EC 2.4.1.1)
*
Thermoanaerobacter italicus Ab9

Site:
position = -74
score = 5.9384
sequence = TTGTGCAACCACTTGCATAA

Gene: Thit_1602: Glycogen phosphorylase (EC 2.4.1.1)
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -76
score = 6.17914
sequence = TTGTGCAAACACTTGCATAA

Gene: TTE1805: Glycogen phosphorylase (EC 2.4.1.1)
Glycogen phosphorylase (EC 2.4.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD