Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog XCC2209 - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a 11 6
Xylella fastidiosa 9a5c
Xanthomonas campestris pv. campestris str. ATCC 33913 12 7
Xanthomonas axonopodis pv. citri str. 306 12 7
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG3137
 
Stenotrophomonas maltophilia K279a

Gene: Smlt4128: Putative salt-induced outer membrane protein
 
Xylella fastidiosa 9a5c

Gene: XF1628: Putative salt-induced outer membrane protein
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -55
score = 5.54814
sequence = TCATGAAATCGCTTTCACCT

Gene: XCC3510: Putative salt-induced outer membrane protein
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -49
score = 5.64343
sequence = TCATGAAATCGCTTTCACCC

Gene: XAC0623: Putative salt-induced outer membrane protein
Putative salt-induced outer membrane protein
 
CRON 2.
omp2
*
Stenotrophomonas maltophilia K279a

Site:
position = -42
score = 5.51813
sequence = ATCTGAAAGCGATTACACCC

Gene: Smlt1175: Putative carbohydrate outer membrane transporter, TonB-dependent
 
Xylella fastidiosa 9a5c
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -124
score = 5.06421
sequence = CAGTGGAATCGATTTCAGCA

Gene: XCC2469: Putative carbohydrate outer membrane transporter, TonB-dependent
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -118
score = 5.34505
sequence = GGATGGAATCGATTTCATCG

Gene: XAC2600: Putative carbohydrate outer membrane transporter, TonB-dependent
Putative carbohydrate outer membrane transporter, TonB-dependent
 
CRON 3.
ugpC
*
Stenotrophomonas maltophilia K279a

Site:
position = -148
score = 5.7533
sequence = ACGTGAAAACGTTTACATGG

Gene: Smlt1794: Multiple sugar ABC transporter, ATP-binding protein
 
Xylella fastidiosa 9a5c

Gene: XF1067: Multiple sugar ABC transporter, ATP-binding protein
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -130
score = 5.80311
sequence = ATGTGAAAACGATTACATGT

Gene: XCC2135: Multiple sugar ABC transporter, ATP-binding protein
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -130
score = 5.80311
sequence = ATGTGAAAACGATTACATGT

Gene: XAC2072: Multiple sugar ABC transporter, ATP-binding protein
Multiple sugar ABC transporter, ATP-binding protein
 
CRON 4.
XCC2209
*
Stenotrophomonas maltophilia K279a

Site:
position = -46
score = 5.65592
sequence = AGATGGAAACGCTTACATTC

Gene: Smlt3255: Transcriptional regulator, LacI family
 
Xylella fastidiosa 9a5c
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -107
score = 5.50786
sequence = ATCTGTAAGCGTTTTCACAA

Site:
position = -61
score = 5.52803
sequence = GTATGAAAACGCTTACAGTC

Gene: XCC2209: Transcriptional regulator, LacI family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -106
score = 5.56585
sequence = ATCTGTAAGCGTTTTCACGC

Site:
position = -60
score = 5.52803
sequence = GTATGAAAACGCTTACAGTC

Gene: XAC2313: Transcriptional regulator, LacI family
Transcriptional regulator, LacI family
omp
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3254: Putative carbohydrate outer membrane transporter, TonB-dependent
 
Xylella fastidiosa 9a5c
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2208: Putative carbohydrate outer membrane transporter, TonB-dependent
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2312: Putative carbohydrate outer membrane transporter, TonB-dependent
Putative carbohydrate outer membrane transporter, TonB-dependent
 
CRON 5.
COG5368
*
Stenotrophomonas maltophilia K279a

Site:
position = -31
score = 5.61436
sequence = CCTTGTAAACGATTTCAGAT

Gene: Smlt3253: Hypothetical sugar hydrolase
 
Xylella fastidiosa 9a5c

Gene: XF2449: Hypothetical sugar hydrolase
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -31
score = 5.86824
sequence = AGATGTAATCGATTACACGA

Gene: XCC2207: Hypothetical sugar hydrolase
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -31
score = 5.92623
sequence = AGATGTAATCGATTACACAC

Gene: XAC2311: Hypothetical sugar hydrolase
Hypothetical sugar hydrolase
ugpB
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3252: Sugar ABC transporter, periplasmic sugar-binding protein
 
Xylella fastidiosa 9a5c

Gene: XF2448: Sugar ABC transporter, periplasmic sugar-binding protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2206: Sugar ABC transporter, periplasmic sugar-binding protein
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2310: Sugar ABC transporter, periplasmic sugar-binding protein
Sugar ABC transporter, periplasmic sugar-binding protein
ugpA
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3251: Sugar ABC transporter, sugar permease protein 1
 
Xylella fastidiosa 9a5c

Gene: XF2447: Sugar ABC transporter, sugar permease protein 1
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2205: Sugar ABC transporter, sugar permease protein 1
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2309: Sugar ABC transporter, sugar permease protein 1
Sugar ABC transporter, sugar permease protein 1
ugpE
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3250: Sugar ABC transporter, sugar permease protein 2
 
Xylella fastidiosa 9a5c

Gene: XF2446: Sugar ABC transporter, sugar permease protein 2
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2204: Sugar ABC transporter, sugar permease protein 2
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2308: Sugar ABC transporter, sugar permease protein 2
Sugar ABC transporter, sugar permease protein 2
COG3408
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3249: Hypothetical sugar binding and hydrolysis protein
 
Xylella fastidiosa 9a5c

Gene: XF2445: Hypothetical sugar binding and hydrolysis protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2203: Hypothetical sugar binding and hydrolysis protein
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2307: Hypothetical sugar binding and hydrolysis protein
Hypothetical sugar binding and hydrolysis protein
 
CRON 6.
bglX
*
Stenotrophomonas maltophilia K279a

Site:
position = -30
score = 5.69664
sequence = GCTTGTAAACGTTTTCATCA

Gene: Smlt0449: Beta-glucosidase (EC 3.2.1.21)
 
Xylella fastidiosa 9a5c

Gene: XF0439: Beta-glucosidase (EC 3.2.1.21)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -27
score = 5.75767
sequence = CCATGTAAACGTTTTCTCAA

Gene: XCC3814: Beta-glucosidase (EC 3.2.1.21)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -27
score = 5.75767
sequence = CCATGTAAACGTTTTCTCAA

Gene: XAC3869: Beta-glucosidase (EC 3.2.1.21)
Beta-glucosidase (EC 3.2.1.21)
 
CRON 7.
PF10947
*
Stenotrophomonas maltophilia K279a

Site:
position = -36
score = 5.69804
sequence = TCATGAAAACGTTTTCTCAC

Gene: Smlt4137: hypothetical protein
 
Xylella fastidiosa 9a5c
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -33
score = 5.61934
sequence = TCATGTAAACGCTTTCAATC

Gene: XCC4223: hypothetical protein
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -32
score = 5.74942
sequence = TCATGTAAACGTTTACAACT

Gene: XAC4357: hypothetical protein
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD