Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895 5 2
Edwardsiella tarda EIB202
Enterobacter sp. 638 5 2
Erwinia amylovora ATCC 49946 5 2
Erwinia carotovora subsp. atroseptica SCRI1043 5 2
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 5 2
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2
Serratia proteamaculans 568 5 2
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrY
*
Citrobacter koseri ATCC BAA-895

Site:
position = -119
score = 6.48475
sequence = TTGTTAAACCGGTTTAGCAA

Site:
position = -59
score = 5.5105
sequence = TGCCTAAACCGGTTTAGCTG

Gene: CKO_02946: Putative sucrose porin
 
Edwardsiella tarda EIB202
*
Enterobacter sp. 638

Site:
position = -120
score = 5.81033
sequence = TTACTAAAACGGTTTAGCAA

Site:
position = -60
score = 6.2699
sequence = AAACTAAACCGGTTTAGCAA

Gene: Ent638_2020: Putative sucrose porin
*
Erwinia amylovora ATCC 49946

Site:
position = -52
score = 5.16576
sequence = CTGTCGAACCGGTTTAGCAT

Gene: EAM_1597: Putative sucrose porin
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -79
score = 6.12366
sequence = AAGAAAAACCGGTTTAGCAA

Gene: ECA0363: Putative sucrose porin
 
Escherichia coli str. K-12 substr. MG1655
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -61
score = 6.11342
sequence = CAACTAAACCGGTTTAGCAA

Site:
position = -119
score = 5.9105
sequence = TTCTTAAACCGGTTTAGCAA

Gene: KPN_00515: Putative sucrose porin
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
*
Serratia proteamaculans 568

Site:
position = -123
score = 5.38087
sequence = TAGCTGAATCGGGTTAGCAA

Site:
position = -63
score = 5.96718
sequence = CTGAAAAACCGGTTTAGCAA

Gene: Spro_4204: Putative sucrose porin
 
Yersinia pestis KIM
Putative sucrose porin
scrA
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02945: PTS system sucrose-specific EIIBC component, EC=2.7.1.69
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_2021: PTS system sucrose-specific EIIBC component, EC=2.7.1.69
 
Erwinia amylovora ATCC 49946

Gene: EAM_1596: PTS system sucrose-specific EIIBC component, EC=2.7.1.69
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0362: PTS system sucrose-specific EIIBC component, EC=2.7.1.69
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00514: PTS system sucrose-specific EIIBC component, EC=2.7.1.69
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4205: PTS system sucrose-specific EIIBC component, EC=2.7.1.69
 
Yersinia pestis KIM
PTS system sucrose-specific EIIBC component, EC=2.7.1.69
scrB
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02944: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_2022: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
 
Erwinia amylovora ATCC 49946

Gene: EAM_1595: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0361: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00513: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4206: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
 
Yersinia pestis KIM
Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
scrR
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02943: Sucrose operon repressor ScrR, LacI family
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_2023: Sucrose operon repressor ScrR, LacI family
 
Erwinia amylovora ATCC 49946

Gene: EAM_1594: Sucrose operon repressor ScrR, LacI family
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0360: Sucrose operon repressor ScrR, LacI family
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00512: Sucrose operon repressor ScrR, LacI family
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4207: Sucrose operon repressor ScrR, LacI family
 
Yersinia pestis KIM
Sucrose operon repressor ScrR, LacI family
 
CRON 2.
scrK
*
Citrobacter koseri ATCC BAA-895

Site:
position = -40
score = 5.69402
sequence = TAGCTAAATCGGTTTAACGT

Gene: CKO_02947: Fructokinase (EC 2.7.1.4)
 
Edwardsiella tarda EIB202
*
Enterobacter sp. 638

Site:
position = -41
score = 6.36153
sequence = TAGCTAAACCGGTTTAACAT

Gene: Ent638_2019: Fructokinase (EC 2.7.1.4)
*
Erwinia amylovora ATCC 49946

Site:
position = -51
score = 5.6795
sequence = AGGCTAAACCCGTTTAGCTT

Gene: EAM_1598: Fructokinase (EC 2.7.1.4)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -61
score = 5.54526
sequence = TAGCTAAACCGATTCTTCTA

Gene: ECA0364: Fructokinase (EC 2.7.1.4)
 
Escherichia coli str. K-12 substr. MG1655
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -45
score = 5.83742
sequence = GAGCTAAACCGGTTTAATAA

Gene: KPN_00516: Fructokinase (EC 2.7.1.4)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320

Gene: PMI2189: Fructokinase (EC 2.7.1.4)
 
Salmonella typhimurium LT2

Gene: STM4066: Fructokinase (EC 2.7.1.4)
*
Serratia proteamaculans 568

Site:
position = -62
score = 5.89607
sequence = TTGCTAAACCGGTTCTTCTA

Gene: Spro_4203: Fructokinase (EC 2.7.1.4)
 
Yersinia pestis KIM
Fructokinase (EC 2.7.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD