Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alteromonadales bacterium TW-7 9 6
Alteromonas macleodii 'Deep ecotype' 12 6
Colwellia psychrerythraea 34H 10 7
Glaciecola sp. HTCC2999 7 4
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Pseudoalteromonas atlantica T6c 14 7
Pseudoalteromonas haloplanktis TAC125 8 4
Pseudoalteromonas tunicata D2 7 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
malZ
*
Alteromonadales bacterium TW-7

Site:
position = -124
score = 5.91903
sequence = TTGTGCATACGTATGCAGTC

Gene: ATW7_07444: Maltodextrin glucosidase (EC 3.2.1.20)
 
Alteromonas macleodii 'Deep ecotype'
*
Colwellia psychrerythraea 34H

Site:
position = -149
score = 5.74289
sequence = TTATACATACGTATGCAAAG

Site:
position = -220
score = 5.98268
sequence = TCTTGAATACGTATGCAAGG

Site:
position = -180
score = 6.06924
sequence = TATTACATACGTATGCAATT

Gene: CPS_0984: Maltodextrin glucosidase (EC 3.2.1.20)
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -129
score = 6.10375
sequence = TAGTGCATACGTATGCAGTA

Gene: PSHAa1351: Maltodextrin glucosidase (EC 3.2.1.20)
*
Pseudoalteromonas tunicata D2

Site:
position = -125
score = 5.8739
sequence = AAATGCATACGTATGCATGC

Gene: PTD2_18670: Maltodextrin glucosidase (EC 3.2.1.20)
Maltodextrin glucosidase (EC 3.2.1.20)
 
CRON 2.
amyA
*2
Alteromonadales bacterium TW-7

Gene: ATW7_07419: Alpha-amylase (EC 3.2.1.1)

Site:
position = -86
score = 5.88993
sequence = ACCTGAATACGTATGCAGCA

Gene: ATW7_07424: Alpha-amylase (EC 3.2.1.1)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -130
score = 6.03707
sequence = TTTTGAATACGTATGCATGT

Gene: MADE_01887: Alpha-amylase (EC 3.2.1.1)
 
Colwellia psychrerythraea 34H
*
Glaciecola sp. HTCC2999

Site:
position = -99
score = 4.75559
sequence = ATATGAAATCGTATGCAGGG

Gene: GHTCC_010100005130: Alpha-amylase (EC 3.2.1.1)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -95
score = 5.44769
sequence = TGATGAATACGTATGTAGGG

Gene: Patl_2340: Alpha-amylase (EC 3.2.1.1)
*2
Pseudoalteromonas haloplanktis TAC125

Site:
position = -91
score = 5.82896
sequence = AACTGAATACGTATGCAGCG

Gene: PSHAa1355: Alpha-amylase (EC 3.2.1.1)

Gene: PSHAa1357: Alpha-amylase (EC 3.2.1.1)
*
Pseudoalteromonas tunicata D2

Site:
position = -83
score = 6.09858
sequence = GACTGAATACGTATGCAATT

Gene: PTD2_18700: Alpha-amylase (EC 3.2.1.1)
Alpha-amylase (EC 3.2.1.1)
pulA2
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2339: Putative pullulanase (Alpha-dextrin endo-1,6-alpha-glucosidase) EC=3.2.1.41
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Putative pullulanase (Alpha-dextrin endo-1,6-alpha-glucosidase) EC=3.2.1.41
aglA
 
Alteromonadales bacterium TW-7
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -120
score = 4.92389
sequence = CAATGAATACGTATGTTTAT

Gene: MADE_03950: Alpha-glucosidase (EC 3.2.1.20)
*
Colwellia psychrerythraea 34H

Site:
position = -131
score = 6.06924
sequence = AATTGCATACGTATGTAATA

Site:
position = -91
score = 5.98268
sequence = CCTTGCATACGTATTCAAGA

Site:
position = -162
score = 5.74289
sequence = CTTTGCATACGTATGTATAA

Gene: CPS_0983: Alpha-glucosidase (EC 3.2.1.20)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100005135: Alpha-glucosidase (EC 3.2.1.20)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2338: Alpha-glucosidase (EC 3.2.1.20)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Alpha-glucosidase (EC 3.2.1.20)
malT2
 
Alteromonadales bacterium TW-7

Gene: ATW7_07414: Predicted maltose transporter MalT
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1356: Predicted maltose transporter MalT
 
Pseudoalteromonas tunicata D2

Gene: PTD2_18705: Predicted maltose transporter MalT
Predicted maltose transporter MalT
glk
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_0982: Glucokinase (EC 2.7.1.2)
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Glucokinase (EC 2.7.1.2)
 
CRON 3.
amyA3
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
*
Colwellia psychrerythraea 34H

Site:
position = -129
score = 5.53181
sequence = TTATGAATACGTATGTAGGG

Gene: CPS_3370: Alpha-amylase precursor (EC 3.2.1.1)
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Alpha-amylase precursor (EC 3.2.1.1)
 
CRON 4.
glgP
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
*
Glaciecola sp. HTCC2999

Site:
position = -122
score = 5.35222
sequence = AAATGCATACGAATTCAGTC

Gene: GHTCC_010100010210: Glycogen phosphorylase (EC 2.4.1.1)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -166
score = 5.81646
sequence = GGTTGAATACGTATTCAACC

Gene: Patl_2197: Glycogen phosphorylase (EC 2.4.1.1)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Glycogen phosphorylase (EC 2.4.1.1)
 
CRON 5.
malQ
 
Alteromonadales bacterium TW-7
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -124
score = 5.17798
sequence = TATTGCAATCGTATTCAGAT

Gene: MADE_01251: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Colwellia psychrerythraea 34H
*
Glaciecola sp. HTCC2999

Site:
position = -83
score = 5.96821
sequence = TTTTGCAAACGTATTCAATA

Gene: GHTCC_010100004775: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -90
score = 5.68746
sequence = TAATGCAAACGTATTCAACT

Gene: Patl_1635: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
glgB
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01252: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100004780: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1636: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
glgX
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01253: Glycogen debranching enzyme (EC 3.2.1.-)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100004785: Glycogen debranching enzyme (EC 3.2.1.-)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1637: Glycogen debranching enzyme (EC 3.2.1.-)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Glycogen debranching enzyme (EC 3.2.1.-)
 
CRON 6.
susB
*
Alteromonadales bacterium TW-7

Site:
position = -85
score = 5.68379
sequence = AAATGAATACGTATGTAGAT

Gene: ATW7_17172: Alpha-glucosidase (EC 3.2.1.20)
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100000760: Alpha-glucosidase (EC 3.2.1.20)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -87
score = 5.74019
sequence = CCCTGAATACGTATGCAACC

Gene: PSHAa2848: Alpha-glucosidase (EC 3.2.1.20)
*
Pseudoalteromonas tunicata D2

Site:
position = -83
score = 5.70911
sequence = GTGTGAATACGTATGCAAGC

Gene: PTD2_01461: Alpha-glucosidase (EC 3.2.1.20)
Alpha-glucosidase (EC 3.2.1.20)
 
CRON 7.
amyA2
*
Alteromonadales bacterium TW-7

Site:
position = -110
score = 6.11193
sequence = TAATGCATACGTATTCAGTT

Gene: ATW7_11801: Alpha-amylase precursor (EC 3.2.1.1)
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -131
score = 5.77673
sequence = ATTTACATACGTATTCATTT

Gene: Patl_2859: Alpha-amylase precursor (EC 3.2.1.1)
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -83
score = 6.12423
sequence = TTTTGCATACGTATTCAAAG

Gene: PTD2_20842: Alpha-amylase precursor (EC 3.2.1.1)
Alpha-amylase precursor (EC 3.2.1.1)
 
CRON 8.
susA
 
Alteromonadales bacterium TW-7

Gene: ATW7_07429: Neopullulanase (EC 3.2.1.135)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -97
score = 5.51473
sequence = CGGTGAATACGTATGCAGAG

Gene: MADE_01888: Neopullulanase (EC 3.2.1.135)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1354: Neopullulanase (EC 3.2.1.135)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_18690: Neopullulanase (EC 3.2.1.135)
Neopullulanase (EC 3.2.1.135)
malT
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01889: Predicted maltose transporter MalT
*
Colwellia psychrerythraea 34H

Site:
position = -219
score = 5.71084
sequence = TAGTGAATACGTATGTAACA

Gene: CPS_0975: Predicted maltose transporter MalT
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -213
score = 5.93078
sequence = ATCTGAATACGTATGCAAGC

Gene: Patl_2187: Predicted maltose transporter MalT
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Predicted maltose transporter MalT
cgt
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01890: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
 
Colwellia psychrerythraea 34H
*
Glaciecola sp. HTCC2999

Site:
position = -79
score = 5.67266
sequence = ATGTGAATACGTATGTAAAA

Gene: GHTCC_010100006907: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2186: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Cyclomaltodextrin glucanotransferase EC=2.4.1.19
omp(Mal)
*
Alteromonadales bacterium TW-7

Site:
position = -139
score = 5.97465
sequence = GCTTGAATACGTATGCATAA

Gene: ATW7_07439: Predicted maltose-specific outer membrane transporter, TonB-dependent
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -134
score = 6.05308
sequence = TATTGAATACGTATGCAGGC

Gene: MADE_01879: Predicted maltose-specific outer membrane transporter, TonB-dependent
*
Colwellia psychrerythraea 34H

Site:
position = -207
score = 5.90837
sequence = CGTTGCATACGTATTCAATG

Site:
position = -166
score = 5.76692
sequence = CTCTGAATACGTATGCAACG

Gene: CPS_0993: Predicted maltose-specific outer membrane transporter, TonB-dependent
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*2
Pseudoalteromonas atlantica T6c

Gene: Patl_3818: Predicted maltose-specific outer membrane transporter, TonB-dependent

Site:
position = -144
score = 6.18928
sequence = TACTGAATACGTATGCAAGA

Gene: Patl_1938: Predicted maltose-specific outer membrane transporter, TonB-dependent
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -117
score = 6.09751
sequence = TGTTGAATACGTATGCATAA

Gene: PSHAa1352: Predicted maltose-specific outer membrane transporter, TonB-dependent
*
Pseudoalteromonas tunicata D2

Site:
position = -153
score = 6.12385
sequence = TTTTGAATACGTATGCAGTC

Gene: PTD2_18680: Predicted maltose-specific outer membrane transporter, TonB-dependent
Predicted maltose-specific outer membrane transporter, TonB-dependent
trpH
 
Alteromonadales bacterium TW-7

Gene: ATW7_07434: Tryptophan halogenase
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01880: Tryptophan halogenase
 
Colwellia psychrerythraea 34H

Gene: CPS_0992: Tryptophan halogenase
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 2
Pseudoalteromonas atlantica T6c

Gene: Patl_3817: Tryptophan halogenase

Gene: Patl_1939: Tryptophan halogenase
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1353: Tryptophan halogenase
 
Pseudoalteromonas tunicata D2

Gene: PTD2_18685: Tryptophan halogenase
Tryptophan halogenase
 
CRON 9.
omp(Mal)2
*
Alteromonadales bacterium TW-7

Site:
position = -108
score = 6.05308
sequence = TACTGCATACGTATTCATCA

Gene: ATW7_17257: Predicted maltose-specific outer membrane transporter, TonB-dependent
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -130
score = 5.72392
sequence = AAATGAATACGTATGCACAG

Gene: MADE_01881: Predicted maltose-specific outer membrane transporter, TonB-dependent
*
Colwellia psychrerythraea 34H

Site:
position = -129
score = 6.30448
sequence = TTTTGAATACGTATGCAAAA

Gene: CPS_1693: Predicted maltose-specific outer membrane transporter, TonB-dependent
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -167
score = 5.99568
sequence = TGTTGAATACGTATGCAGTG

Gene: Patl_1940: Predicted maltose-specific outer membrane transporter, TonB-dependent
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Predicted maltose-specific outer membrane transporter, TonB-dependent
pulA
 
Alteromonadales bacterium TW-7

Gene: ATW7_17262: Alpha-1,6-glucosidases, pullulanase-type
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01882: Alpha-1,6-glucosidases, pullulanase-type
*2
Colwellia psychrerythraea 34H

Site:
position = -94
score = 5.72088
sequence = GCTTGAATACGTATGTAAGA

Gene: CPS_0996: Alpha-1,6-glucosidases, pullulanase-type

Gene: CPS_1694: Alpha-1,6-glucosidases, pullulanase-type
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1941: Alpha-1,6-glucosidases, pullulanase-type
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Alpha-1,6-glucosidases, pullulanase-type
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD