Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961 4 4
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633
Vibrio salmonicida LFI1238
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrB
 
Photobacterium profundum SS9
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -39
score = 5.70083
sequence = AATTGAGAACGTTCCCGAAT

Gene: VCA0655: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
CRON 2.
scrK
 
Photobacterium profundum SS9
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -117
score = 5.54847
sequence = AATAGGTAACGTTCCCGAAA

Gene: VCA0656: Fructokinase (EC 2.7.1.4)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_21069: Fructokinase (EC 2.7.1.4)
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Fructokinase (EC 2.7.1.4)
 
CRON 3.
scrR
 
Photobacterium profundum SS9
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -192
score = 6.17356
sequence = TTTCGGGAACGTTTGCAAAA

Gene: VCA0654: Sucrose operon repressor ScrR, LacI family
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Sucrose operon repressor ScrR, LacI family
 
CRON 4.
scrA
 
Photobacterium profundum SS9
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -128
score = 6.17356
sequence = TTTTGCAAACGTTCCCGAAA

Gene: VCA0653: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD