Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GalR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alteromonadales bacterium TW-7
Alteromonas macleodii 'Deep ecotype' 6 4
Colwellia psychrerythraea 34H
Glaciecola sp. HTCC2999
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Pseudoalteromonas atlantica T6c
Pseudoalteromonas haloplanktis TAC125 5 2
Pseudoalteromonas tunicata D2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
galR
 
Alteromonadales bacterium TW-7
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -169
score = 5.28413
sequence = GAGGTTATACGTTTTCCGTT

Gene: MADE_00229: Transcriptional regulator for galactose utilization, LacI family
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 2
Pseudoalteromonas atlantica T6c

Gene: Patl_2679: Transcriptional regulator for galactose utilization, LacI family

Gene: Patl_2681: Transcriptional regulator for galactose utilization, LacI family
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -111
score = 6.31547
sequence = AAGGGTAAACGCTTACCCCG

Gene: PSHAa1771: Transcriptional regulator for galactose utilization, LacI family
 
Pseudoalteromonas tunicata D2
Transcriptional regulator for galactose utilization, LacI family
 
CRON 2.
omp_Gal
 
Alteromonadales bacterium TW-7
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -140
score = 6.06778
sequence = TATGGTAAACGTTTACCCAA

Gene: MADE_00241: Predicted galactose-specific outer membrane transporter, TonB-dependent
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Predicted galactose-specific outer membrane transporter, TonB-dependent
lacZ
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00239: Beta-galactosidase (EC 3.2.1.23)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Beta-galactosidase (EC 3.2.1.23)
 
CRON 3.
galT
 
Alteromonadales bacterium TW-7

Gene: ATW7_15001: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -136
score = 6.38072
sequence = TAGGGTAAACGTTTAACCCT

Gene: MADE_00231: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0648: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -54
score = 6.31547
sequence = CGGGGTAAGCGTTTACCCTT

Gene: PSHAa1770: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
 
Pseudoalteromonas tunicata D2
Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
galK
 
Alteromonadales bacterium TW-7

Gene: ATW7_15006: Galactokinase (EC 2.7.1.6)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00232: Galactokinase (EC 2.7.1.6)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0647: Galactokinase (EC 2.7.1.6)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1769: Galactokinase (EC 2.7.1.6)
 
Pseudoalteromonas tunicata D2
Galactokinase (EC 2.7.1.6)
galP
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00234: Predicted sodium-dependent galactose transporter
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2683: Predicted sodium-dependent galactose transporter
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1768: Predicted sodium-dependent galactose transporter
 
Pseudoalteromonas tunicata D2
Predicted sodium-dependent galactose transporter
galM
 
Alteromonadales bacterium TW-7

Gene: ATW7_15071: Aldose 1-epimerase (EC 5.1.3.3)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -123
score = 5.28413
sequence = AACGGAAAACGTATAACCTC

Gene: MADE_00230: Aldose 1-epimerase (EC 5.1.3.3)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1767: Aldose 1-epimerase (EC 5.1.3.3)
 
Pseudoalteromonas tunicata D2
Aldose 1-epimerase (EC 5.1.3.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD