Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria welshimeri serovar 6b str. SLCC5334 6 2
Listeria seeligeri serovar 1/2b str. SLCC3954 6 2
Listeria monocytogenes EGD-e 6 2
Listeria innocua Clip11262 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglX
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -290
score = 6.74215
sequence = TCATAGAAACGTTTCGACAA

Gene: lwe1746: Beta-glucosidase (EC 3.2.1.21)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -289
score = 6.52852
sequence = CTATAGAAACGTTTCGACAA

Gene: lse_1700: Beta-glucosidase (EC 3.2.1.21)
*
Listeria monocytogenes EGD-e

Site:
position = -289
score = 6.74215
sequence = TCATAGAAACGTTTCGACAA

Gene: lmo1729: Beta-glucosidase (EC 3.2.1.21)
*
Listeria innocua Clip11262

Site:
position = -290
score = 6.74215
sequence = TCATAGAAACGTTTCGACAA

Gene: lin1840: Beta-glucosidase (EC 3.2.1.21)
Beta-glucosidase (EC 3.2.1.21)
cbpA
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1745: Cellobiose phosphorylase (EC 2.4.1.-)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1699: Cellobiose phosphorylase (EC 2.4.1.-)
 
Listeria monocytogenes EGD-e

Gene: lmo1728: Cellobiose phosphorylase (EC 2.4.1.-)
 
Listeria innocua Clip11262

Gene: lin1839: Cellobiose phosphorylase (EC 2.4.1.-)
Cellobiose phosphorylase (EC 2.4.1.-)
bglR
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1744: Transcriptional regulator for beta-glucoside utilization, LacI family
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1698: Transcriptional regulator for beta-glucoside utilization, LacI family
 
Listeria monocytogenes EGD-e

Gene: lmo1727: Transcriptional regulator for beta-glucoside utilization, LacI family
 
Listeria innocua Clip11262

Gene: lin1838: Transcriptional regulator for beta-glucoside utilization, LacI family
Transcriptional regulator for beta-glucoside utilization, LacI family
 
CRON 2.
bglA
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -160
score = 6.74215
sequence = TTGTCGAAACGTTTCTATGA

Gene: lwe1747: Predicted beta-glucoside ABC transport system, sugar-binding protein
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -160
score = 6.52852
sequence = TTGTCGAAACGTTTCTATAG

Gene: lse_1701: Predicted beta-glucoside ABC transport system, sugar-binding protein
*
Listeria monocytogenes EGD-e

Site:
position = -158
score = 6.74215
sequence = TTGTCGAAACGTTTCTATGA

Gene: lmo1730: Predicted beta-glucoside ABC transport system, sugar-binding protein
*
Listeria innocua Clip11262

Site:
position = -158
score = 6.74215
sequence = TTGTCGAAACGTTTCTATGA

Gene: lin1841: Predicted beta-glucoside ABC transport system, sugar-binding protein
Predicted beta-glucoside ABC transport system, sugar-binding protein
bglB
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1748: Predicted beta-glucoside ABC transport system, permease protein 1
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1702: Predicted beta-glucoside ABC transport system, permease protein 1
 
Listeria monocytogenes EGD-e

Gene: lmo1731: Predicted beta-glucoside ABC transport system, permease protein 1
 
Listeria innocua Clip11262

Gene: lin1842: Predicted beta-glucoside ABC transport system, permease protein 1
Predicted beta-glucoside ABC transport system, permease protein 1
bglC
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1749: Predicted beta-glucoside ABC transport system, permease protein 2
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1703: Predicted beta-glucoside ABC transport system, permease protein 2
 
Listeria monocytogenes EGD-e

Gene: lmo1732: Predicted beta-glucoside ABC transport system, permease protein 2
 
Listeria innocua Clip11262

Gene: lin1843: Predicted beta-glucoside ABC transport system, permease protein 2
Predicted beta-glucoside ABC transport system, permease protein 2
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD