Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IolR - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1 10 2
Arthrobacter chlorophenolicus A6 7 4
Arthrobacter sp. FB24
Beutenbergia cavernae DSM 12333
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iolR
*
Arthrobacter aurescens TC1

Site:
position = -91
score = 6.42979
sequence = ATTTTGTAGCGCTACAATTT

Gene: AAur_1987: Transcriptional regulator for inositol utilization, LacI family
*
Arthrobacter chlorophenolicus A6

Site:
position = -66
score = 5.60022
sequence = TGTTTGGAGCGCTCCATAAA

Gene: Achl_0116: Transcriptional regulator for inositol utilization, LacI family
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Transcriptional regulator for inositol utilization, LacI family
inoC
 
Arthrobacter aurescens TC1

Gene: AAur_1988: Predicted inositol ABC transport system, sugar-binding protein
*
Arthrobacter chlorophenolicus A6

Site:
position = -104
score = 5.67965
sequence = TTCATGGAGCGCTCCAAATG

Gene: Achl_0113: Predicted inositol ABC transport system, sugar-binding protein
 
Arthrobacter sp. FB24

Gene: Arth_0830: Predicted inositol ABC transport system, sugar-binding protein
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_3164: Predicted inositol ABC transport system, sugar-binding protein
 
Tropheryma whipplei str. Twist
Predicted inositol ABC transport system, sugar-binding protein
inoB
 
Arthrobacter aurescens TC1

Gene: AAur_1989: Predicted inositol ABC transport system, permease protein
 
Arthrobacter chlorophenolicus A6

Gene: Achl_0114: Predicted inositol ABC transport system, permease protein
 
Arthrobacter sp. FB24

Gene: Arth_0831: Predicted inositol ABC transport system, permease protein
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_3163: Predicted inositol ABC transport system, permease protein
 
Tropheryma whipplei str. Twist
Predicted inositol ABC transport system, permease protein
inoC
 
Arthrobacter aurescens TC1

Gene: AAur_1990: Predicted inositol ABC transport system, ATP-binding protein
 
Arthrobacter chlorophenolicus A6

Gene: Achl_0115: Predicted inositol ABC transport system, ATP-binding protein
 
Arthrobacter sp. FB24

Gene: Arth_0832: Predicted inositol ABC transport system, ATP-binding protein
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_3162: Predicted inositol ABC transport system, ATP-binding protein
 
Tropheryma whipplei str. Twist
Predicted inositol ABC transport system, ATP-binding protein
iolG1
 
Arthrobacter aurescens TC1

Gene: AAur_1992: putative myo-inositol 2-dehydrogenase
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810

Gene: Bfae_26160: putative myo-inositol 2-dehydrogenase
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_03620: putative myo-inositol 2-dehydrogenase
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
putative myo-inositol 2-dehydrogenase
iolG2
 
Arthrobacter aurescens TC1

Gene: AAur_1993: putative myo-inositol 2-dehydrogenase
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_0833: putative myo-inositol 2-dehydrogenase
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
putative myo-inositol 2-dehydrogenase
iolG3
 
Arthrobacter aurescens TC1

Gene: AAur_1994: putative myo-inositol 2-dehydrogenase
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_0834: putative myo-inositol 2-dehydrogenase
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_3165: putative myo-inositol 2-dehydrogenase
 
Tropheryma whipplei str. Twist
putative myo-inositol 2-dehydrogenase
iolG4
*
Arthrobacter aurescens TC1

Site:
position = 44
score = 6.42979
sequence = AAATTGTAGCGCTACAAAAT

Gene: AAur_1986: putative myo-inositol 2-dehydrogenase
*
Arthrobacter chlorophenolicus A6

Site:
position = -90
score = 5.60022
sequence = TTTATGGAGCGCTCCAAACA

Gene: Achl_0117: putative myo-inositol 2-dehydrogenase
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
putative myo-inositol 2-dehydrogenase
iolE
 
Arthrobacter aurescens TC1

Gene: AAur_1985: Inosose dehydratase (EC 4.2.1.44)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_0119: Inosose dehydratase (EC 4.2.1.44)
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Inosose dehydratase (EC 4.2.1.44)
iolG5
 
Arthrobacter aurescens TC1

Gene: AAur_1984: putative myo-inositol 2-dehydrogenase
*
Arthrobacter chlorophenolicus A6

Site:
position = -18
score = 6.18191
sequence = TTATTGGAGCGCTCCATAAT

Gene: Achl_0112: putative myo-inositol 2-dehydrogenase
 
Arthrobacter sp. FB24

Gene: Arth_1058: putative myo-inositol 2-dehydrogenase
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
putative myo-inositol 2-dehydrogenase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD