Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CC1627 - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 9 4
Caulobacter segnis ATCC 21756 8 3
Caulobacter sp. K31 11 5
Phenylobacterium zucineum HLK1 8 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
CC1628
*
Caulobacter crescentus CB15

Site:
position = -81
score = 4.72593
sequence = CGATGAATTCGATTACATTG

Gene: CC1628: nucleoside:H symporter
*
Caulobacter segnis ATCC 21756

Site:
position = -81
score = 4.40495
sequence = CGATGATTTCGATTACATCG

Gene: Cseg_2113: nucleoside:H symporter
*
Caulobacter sp. K31

Site:
position = -83
score = 4.3289
sequence = CGATGATTTCGATTACATCA

Gene: Caul_4612: nucleoside:H symporter
*
Phenylobacterium zucineum HLK1

Site:
position = -67
score = 5.36433
sequence = ACGTGTAATCGATTACATCG

Gene: PHZ_c2157: nucleoside:H symporter
nucleoside:H symporter
CC1629
 
Caulobacter crescentus CB15

Gene: CC1629: Sugar phosphate isomerases/epimerases
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2112: Sugar phosphate isomerases/epimerases
 
Caulobacter sp. K31

Gene: Caul_4611: Sugar phosphate isomerases/epimerases
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2156: Sugar phosphate isomerases/epimerases
Sugar phosphate isomerases/epimerases
CC1630
 
Caulobacter crescentus CB15

Gene: CC1630: Oxidoreductase (EC 1.1.1.-)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2111: Oxidoreductase (EC 1.1.1.-)
*2
Caulobacter sp. K31

Gene: Caul_4610: Oxidoreductase (EC 1.1.1.-)

Site:
position = -51
score = 4.82579
sequence = ATATGTAATCGAATACACAA

Gene: Caul_0426: Oxidoreductase (EC 1.1.1.-)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2155: Oxidoreductase (EC 1.1.1.-)
Oxidoreductase (EC 1.1.1.-)
CC1631
 
Caulobacter crescentus CB15

Gene: CC1631: Sugar phosphate isomerases/epimerases
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2110: Sugar phosphate isomerases/epimerases
 2
Caulobacter sp. K31

Gene: Caul_4609: Sugar phosphate isomerases/epimerases

Gene: Caul_0427: Sugar phosphate isomerases/epimerases
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2154: Sugar phosphate isomerases/epimerases
Sugar phosphate isomerases/epimerases
CC1634
*
Caulobacter crescentus CB15

Site:
position = -117
score = 4.71282
sequence = CAATGTAACCCATTTCATGG

Gene: CC1634: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
*
Caulobacter segnis ATCC 21756

Site:
position = -119
score = 4.71282
sequence = CAATGTAACCCATTTCATGG

Gene: Cseg_2107: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
*
Caulobacter sp. K31

Site:
position = -118
score = 4.71282
sequence = CAATGTAACCCATTTCATGG

Gene: Caul_4606: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2153: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
CC1635
 
Caulobacter crescentus CB15

Gene: CC1635: hypothetical protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2106: hypothetical protein
 
Caulobacter sp. K31

Gene: Caul_4605: hypothetical protein
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2152: hypothetical protein
hypothetical protein
PHZ_c2151
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2151: hypothetical protein
hypothetical protein
cyc
 
Caulobacter crescentus CB15

Gene: CC1632: Cytochrome c2
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2109: Cytochrome c2
 
Caulobacter sp. K31

Gene: Caul_4608: Cytochrome c2
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0286: Cytochrome c2
Cytochrome c2
 
CRON 2.
CC1627
*
Caulobacter crescentus CB15

Site:
position = -116
score = 4.72593
sequence = CAATGTAATCGAATTCATCG

Gene: CC1627: Transcriptional regulator, LacI family
*
Caulobacter segnis ATCC 21756

Site:
position = -118
score = 4.40495
sequence = CGATGTAATCGAAATCATCG

Gene: Cseg_2114: Transcriptional regulator, LacI family
*
Caulobacter sp. K31

Site:
position = -119
score = 4.3289
sequence = TGATGTAATCGAAATCATCG

Gene: Caul_4613: Transcriptional regulator, LacI family
*
Phenylobacterium zucineum HLK1

Site:
position = -40
score = 5.36433
sequence = CGATGTAATCGATTACACGT

Gene: PHZ_c2158: Transcriptional regulator, LacI family
Transcriptional regulator, LacI family
 
CRON 3.
PF06439
*
Caulobacter crescentus CB15

Site:
position = -54
score = 4.71282
sequence = CCATGAAATGGGTTACATTG

Gene: CC1633: Domain of Unknown Function (DUF1080)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2108: Domain of Unknown Function (DUF1080)
*
Caulobacter sp. K31

Site:
position = -78
score = 4.71282
sequence = CCATGAAATGGGTTACATTG

Gene: Caul_4607: Domain of Unknown Function (DUF1080)
 
Phenylobacterium zucineum HLK1
Domain of Unknown Function (DUF1080)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD