Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Jann_1459 - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1 10 2
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597 8 2
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222 6 2
Rhodobacter sphaeroides 2.4.1 6 2
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Jann_1460
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -92
score = 5.40262
sequence = GTATGTAATCGATTTCAGAG

Gene: Jann_1460: short-chain dehydrogenase/reductase SDR
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
short-chain dehydrogenase/reductase SDR
Jann_1461
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1461: oxidoreductase-like
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_05468: oxidoreductase-like
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
oxidoreductase-like
COG1082
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1462: Sugar phosphate isomerases/epimerases
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -50
score = 5.07918
sequence = GGATGTAATCGATTTCAAGG

Gene: OB2597_08884: Sugar phosphate isomerases/epimerases
 
Oceanicola granulosus HTCC2516

Gene: OG2516_05463: Sugar phosphate isomerases/epimerases
*
Paracoccus denitrificans PD1222

Site:
position = -54
score = 4.91066
sequence = GTTTGCAATCGATTGCAGAC

Gene: Pden_4767: Sugar phosphate isomerases/epimerases
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -109
score = 4.3248
sequence = CGTTGTAAACGTTTGTCGCG

Site:
position = -77
score = 5.70327
sequence = CTCTGCAAACGATTACATCA

Gene: RSP_1244: Sugar phosphate isomerases/epimerases
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar phosphate isomerases/epimerases
SMb20720
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1463: Sugar ABC transport system, substrate-binding protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08854: Sugar ABC transport system, substrate-binding protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_05458: Sugar ABC transport system, substrate-binding protein
 
Paracoccus denitrificans PD1222

Gene: Pden_4771: Sugar ABC transport system, substrate-binding protein
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1249: Sugar ABC transport system, substrate-binding protein
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transport system, substrate-binding protein
SMb20718
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1464: Sugar ABC transport system, ATP-binding protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08869: Sugar ABC transport system, ATP-binding protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_05453: Sugar ABC transport system, ATP-binding protein
 
Paracoccus denitrificans PD1222

Gene: Pden_4769: Sugar ABC transport system, ATP-binding protein
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1247: Sugar ABC transport system, ATP-binding protein
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transport system, ATP-binding protein
SMb20719
 
Hyphomonas neptunium ATCC 15444
 2
Jannaschia sp. CCS1

Gene: Jann_1465: SugarABC transport system, inner membrane protein

Gene: Jann_1466: SugarABC transport system, inner membrane protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 2
Oceanicola batsensis HTCC2597

Gene: OB2597_08864: SugarABC transport system, inner membrane protein

Gene: OB2597_08859: SugarABC transport system, inner membrane protein
 2
Oceanicola granulosus HTCC2516

Gene: OG2516_05448: SugarABC transport system, inner membrane protein

Gene: OG2516_05443: SugarABC transport system, inner membrane protein
 
Paracoccus denitrificans PD1222

Gene: Pden_4770: SugarABC transport system, inner membrane protein
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_6150: SugarABC transport system, inner membrane protein
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
SugarABC transport system, inner membrane protein
COG0673
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1467: Predicted dehydrogenases and related proteins
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08879: Predicted dehydrogenases and related proteins
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4768: Predicted dehydrogenases and related proteins
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1245: Predicted dehydrogenases and related proteins
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Predicted dehydrogenases and related proteins
Jann_1468
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1468: oxidoreductase-like
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
oxidoreductase-like
OB2597_08874
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08874: Putative isomerase/epimerase
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Putative isomerase/epimerase
 
CRON 2.
Jann_1459
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -74
score = 5.40262
sequence = CTCTGAAATCGATTACATAC

Gene: Jann_1459: Transcriptional regulator, LacI family
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -84
score = 5.07918
sequence = CCTTGAAATCGATTACATCC

Gene: OB2597_08889: Transcriptional regulator, LacI family
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -62
score = 4.91066
sequence = GTCTGCAATCGATTGCAAAC

Gene: Pden_4766: Transcriptional regulator, LacI family
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -93
score = 5.70327
sequence = TGATGTAATCGTTTGCAGAG

Site:
position = -61
score = 4.3248
sequence = CGCGACAAACGTTTACAACG

Gene: RSP_1243: Transcriptional regulator, LacI family
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD