Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GluR - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 14 6
Caulobacter segnis ATCC 21756 14 6
Caulobacter sp. K31 11 5
Phenylobacterium zucineum HLK1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pykA
*
Caulobacter crescentus CB15

Site:
position = -216
score = 5.11845
sequence = TAACGTCAACGTTGTCAGGT

Gene: CC2051: Pyruvate kinase (EC 2.7.1.40)
*
Caulobacter segnis ATCC 21756

Site:
position = -219
score = 4.63615
sequence = TTACGTCAACGTTTTCAGGC

Gene: Cseg_1380: Pyruvate kinase (EC 2.7.1.40)
*
Caulobacter sp. K31

Site:
position = -119
score = 5.73925
sequence = GCTAGACAACGTTGTCAGGC

Gene: Caul_1443: Pyruvate kinase (EC 2.7.1.40)
 
Phenylobacterium zucineum HLK1
Pyruvate kinase (EC 2.7.1.40)
 
CRON 2.
sucC
*
Caulobacter crescentus CB15

Site:
position = -259
score = 5.90396
sequence = TTATGACAACGTTGCCATTG

Gene: CC0337: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
*
Caulobacter segnis ATCC 21756

Site:
position = -224
score = 4.42551
sequence = GATGGAAAGCGTTGTCATCG

Gene: Cseg_3807: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
*
Caulobacter sp. K31

Site:
position = -245
score = 6.03245
sequence = CCATGACAAGGCTGTCATTC

Gene: Caul_0229: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0158: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
sucD
 
Caulobacter crescentus CB15

Gene: CC0338: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3806: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
 
Caulobacter sp. K31

Gene: Caul_0230: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0159: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
sucA
 
Caulobacter crescentus CB15

Gene: CC_0339: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3805: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
 
Caulobacter sp. K31

Gene: Caul_0231: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0160: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
sucB
 
Caulobacter crescentus CB15

Gene: CC0340: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3804: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
 
Caulobacter sp. K31

Gene: Caul_0232: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0161: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
 
CRON 3.
ppdK
*
Caulobacter crescentus CB15

Site:
position = -198
score = 5.93332
sequence = GCCGGACAACGTTGTCATTG

Gene: CC1471: Pyruvate,phosphate dikinase (EC 2.7.9.1)
*
Caulobacter segnis ATCC 21756

Site:
position = -207
score = 5.61355
sequence = TTTGGACAACGTTGTCATTG

Gene: Cseg_1949: Pyruvate,phosphate dikinase (EC 2.7.9.1)
*
Caulobacter sp. K31

Site:
position = -208
score = 5.99069
sequence = CCGAGACAACGTTGTCATTG

Gene: Caul_2179: Pyruvate,phosphate dikinase (EC 2.7.9.1)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1366: Pyruvate,phosphate dikinase (EC 2.7.9.1)
Pyruvate,phosphate dikinase (EC 2.7.9.1)
 
CRON 4.
gluR
*
Caulobacter crescentus CB15

Site:
position = -67
score = 6.29473
sequence = CCATGACAGCCTTGTCATGG

Gene: CC2053: Predicted transcriptional regulator for central carbohydrate metabolism, LacI family
*
Caulobacter segnis ATCC 21756

Site:
position = -66
score = 6.29473
sequence = CCATGACAGCCTTGTCATGG

Gene: Cseg_1378: Predicted transcriptional regulator for central carbohydrate metabolism, LacI family
*
Caulobacter sp. K31

Site:
position = -68
score = 5.86817
sequence = CCTTGACAAGGCTGTCATGC

Gene: Caul_1442: Predicted transcriptional regulator for central carbohydrate metabolism, LacI family
 
Phenylobacterium zucineum HLK1
Predicted transcriptional regulator for central carbohydrate metabolism, LacI family
 
CRON 5.
zwf
*
Caulobacter crescentus CB15

Site:
position = -73
score = 6.49159
sequence = TCATGACAACGTTGTCATAG

Gene: CC2057: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
*
Caulobacter segnis ATCC 21756

Site:
position = -34
score = 6.49159
sequence = TCATGACAACGTTGTCATAG

Gene: Cseg_1373: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
*
Caulobacter sp. K31

Site:
position = -30
score = 6.49159
sequence = TCATGACAACGTTGTCATAG

Gene: Caul_1438: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c3256: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
pgl
 
Caulobacter crescentus CB15

Gene: CC2056: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1374: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Caulobacter sp. K31

Gene: Caul_1439: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c3253: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
edd
 
Caulobacter crescentus CB15

Gene: CC2055: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1375: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Caulobacter sp. K31

Gene: Caul_1440: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c3252: Phosphogluconate dehydratase (EC 4.2.1.12)
Phosphogluconate dehydratase (EC 4.2.1.12)
glk
 
Caulobacter crescentus CB15

Gene: CC2054: Glucokinase (EC 2.7.1.2)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1376: Glucokinase (EC 2.7.1.2)
 
Caulobacter sp. K31

Gene: Caul_1441: Glucokinase (EC 2.7.1.2)
 2
Phenylobacterium zucineum HLK1

Gene: PHZ_p0117: Glucokinase (EC 2.7.1.2)

Gene: PHZ_c3251: Glucokinase (EC 2.7.1.2)
Glucokinase (EC 2.7.1.2)
 
CRON 6.
gnl
*
Caulobacter crescentus CB15

Site:
position = -56
score = 5.05088
sequence = CGGTGACATCGCTGTCATGG

Gene: CC1224: Gluconolactonase (EC 3.1.1.17)
*
Caulobacter segnis ATCC 21756

Site:
position = -117
score = 5.43666
sequence = CCGTGACATCGCTGTCATGA

Gene: Cseg_2660: Gluconolactonase (EC 3.1.1.17)
 
Caulobacter sp. K31

Gene: Caul_0625: Gluconolactonase (EC 3.1.1.17)
 
Phenylobacterium zucineum HLK1
Gluconolactonase (EC 3.1.1.17)
gfo
 
Caulobacter crescentus CB15

Gene: CC1225: Glucose--fructose oxidoreductase precursor (EC 1.1.99.28) (GFOR)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2659: Glucose--fructose oxidoreductase precursor (EC 1.1.99.28) (GFOR)
 
Caulobacter sp. K31

Gene: Caul_3785: Glucose--fructose oxidoreductase precursor (EC 1.1.99.28) (GFOR)
 
Phenylobacterium zucineum HLK1
Glucose--fructose oxidoreductase precursor (EC 1.1.99.28) (GFOR)
xylB
 
Caulobacter crescentus CB15

Gene: CC1226: Endo-1,4-beta-xylanase (EC 3.2.1.8)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2658: Endo-1,4-beta-xylanase (EC 3.2.1.8)
 
Caulobacter sp. K31

Gene: Caul_3784: Endo-1,4-beta-xylanase (EC 3.2.1.8)
 
Phenylobacterium zucineum HLK1
Endo-1,4-beta-xylanase (EC 3.2.1.8)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD