Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR2 - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 8 3
Caulobacter segnis ATCC 21756 8 3
Caulobacter sp. K31 6 3
Phenylobacterium zucineum HLK1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
glcT
*
Caulobacter crescentus CB15

Site:
position = -124
score = 5.81535
sequence = GGTTGACAACGTTGTCACGT

Gene: CC1103: Predicted glucose transporter in beta-glucoside utilization gene cluster
*
Caulobacter segnis ATCC 21756

Site:
position = -123
score = 5.83661
sequence = GGTTGACAACGTTGTCACGC

Gene: Cseg_1232: Predicted glucose transporter in beta-glucoside utilization gene cluster
*
Caulobacter sp. K31

Site:
position = -69
score = 5.54734
sequence = GCTTGACAACGTTGTCACCG

Gene: Caul_1420: Predicted glucose transporter in beta-glucoside utilization gene cluster
 
Phenylobacterium zucineum HLK1
Predicted glucose transporter in beta-glucoside utilization gene cluster
CC1104
 
Caulobacter crescentus CB15

Gene: CC1104: sodium:dicarboxylate symporter family protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1233: sodium:dicarboxylate symporter family protein
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
sodium:dicarboxylate symporter family protein
bglX3
 
Caulobacter crescentus CB15

Gene: CC1105: Beta-glucosidase (EC 3.2.1.21)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1234: Beta-glucosidase (EC 3.2.1.21)
 
Caulobacter sp. K31

Gene: Caul_3972: Beta-glucosidase (EC 3.2.1.21)
 
Phenylobacterium zucineum HLK1
Beta-glucosidase (EC 3.2.1.21)
 
CRON 2.
bglR2
*
Caulobacter crescentus CB15

Site:
position = -421
score = 6.40853
sequence = GAATGTCAACGTTGTCATTT

Gene: CC0969: Transcriptional regulator of beta-glucoside utilization, LacI family
*
Caulobacter segnis ATCC 21756

Site:
position = -409
score = 6.14052
sequence = GAATGTCAACGTTGTCATTG

Gene: Cseg_3735: Transcriptional regulator of beta-glucoside utilization, LacI family
*
Caulobacter sp. K31

Site:
position = -419
score = 6.38727
sequence = AAATGTCAACGTTGTCATTT

Site:
position = -105
score = 5.90941
sequence = GCATGACATCGTTGTCGTCC

Gene: Caul_2141: Transcriptional regulator of beta-glucoside utilization, LacI family
 
Phenylobacterium zucineum HLK1
Transcriptional regulator of beta-glucoside utilization, LacI family
bglX2
 
Caulobacter crescentus CB15

Gene: CC0968: Beta-glucosidase (EC 3.2.1.21)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3736: Beta-glucosidase (EC 3.2.1.21)
 
Caulobacter sp. K31

Gene: Caul_2140: Beta-glucosidase (EC 3.2.1.21)
 
Phenylobacterium zucineum HLK1
Beta-glucosidase (EC 3.2.1.21)
 
CRON 3.
omp(Bgl)2
*
Caulobacter crescentus CB15

Site:
position = -273
score = 6.40853
sequence = AAATGACAACGTTGACATTC

Gene: CC0970: TonB-dependent uoter membrane transporter for beta-glucosides
*
Caulobacter segnis ATCC 21756

Site:
position = -270
score = 6.14052
sequence = CAATGACAACGTTGACATTC

Gene: Cseg_3734: TonB-dependent uoter membrane transporter for beta-glucosides
*
Caulobacter sp. K31

Site:
position = -242
score = 6.38727
sequence = AAATGACAACGTTGACATTT

Gene: Caul_2142: TonB-dependent uoter membrane transporter for beta-glucosides
 
Phenylobacterium zucineum HLK1
TonB-dependent uoter membrane transporter for beta-glucosides
thl2
 
Caulobacter crescentus CB15

Gene: CC0971: tryptophan halogenase, putative
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3733: tryptophan halogenase, putative
 
Caulobacter sp. K31

Gene: Caul_2143: tryptophan halogenase, putative
 
Phenylobacterium zucineum HLK1
tryptophan halogenase, putative
thl3
 
Caulobacter crescentus CB15

Gene: CC0972: tryptophan halogenase, putative
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3732: tryptophan halogenase, putative
 
Caulobacter sp. K31

Gene: Caul_2144: tryptophan halogenase, putative
 
Phenylobacterium zucineum HLK1
tryptophan halogenase, putative
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD