Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR1 - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 4 1
Caulobacter segnis ATCC 21756
Caulobacter sp. K31 2 1
Phenylobacterium zucineum HLK1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omp(Bgl)1
*
Caulobacter crescentus CB15

Site:
position = -98
score = 6.66168
sequence = AATTGGAAGCGCTTCCATAG

Gene: CC1754: TonB-dependent uoter membrane transporter for beta-glucosides
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -108
score = 6.85606
sequence = TGTTGGAAGCGCTTCCAATG

Gene: Caul_2063: TonB-dependent uoter membrane transporter for beta-glucosides
 
Phenylobacterium zucineum HLK1
TonB-dependent uoter membrane transporter for beta-glucosides
thl1
 
Caulobacter crescentus CB15

Gene: CC1755: Tryptophan halogenase
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_2064: Tryptophan halogenase
 
Phenylobacterium zucineum HLK1
Tryptophan halogenase
bglX1
 
Caulobacter crescentus CB15

Gene: CC1756: Beta-glucosidase (EC 3.2.1.21)
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
Beta-glucosidase (EC 3.2.1.21)
GH30
 
Caulobacter crescentus CB15

Gene: CC1757: Glycosyl hydrolase, family 30
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_2067: Glycosyl hydrolase, family 30
 
Phenylobacterium zucineum HLK1
Glycosyl hydrolase, family 30
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD