Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AduR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Adenosine utilization
Effector: Adenosine
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 7 1
Azorhizobium caulinodans ORS 571
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42 7 1
Rhizobium leguminosarum bv. viciae 3841 7 1
Rhizobium sp. NGR234
Rhodopseudomonas palustris CGA009
Sinorhizobium meliloti 1021 4 1
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
aduR
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -36
score = 7.20731
sequence = CTGATTAAACGTTTAATCAG

Gene: Atu4420: Predicted transcriptional regulator for adenosine utilization, LacI family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -32
score = 7.15467
sequence = CTGATTAAACGATTAATCAG

Gene: RHE_CH03414: Predicted transcriptional regulator for adenosine utilization, LacI family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -34
score = 6.84229
sequence = CTGATTAAACGATTAATCAA

Gene: RL3877: Predicted transcriptional regulator for adenosine utilization, LacI family
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -43
score = 6.34022
sequence = CAGCTTAATCGTTTAATCAT

Gene: SMb21272: Predicted transcriptional regulator for adenosine utilization, LacI family
 
Xanthobacter autotrophicus Py2
Predicted transcriptional regulator for adenosine utilization, LacI family
aduA
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4421: Predicted adenosine ABC transporter, substrate-binding protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH03415: Predicted adenosine ABC transporter, substrate-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3878: Predicted adenosine ABC transporter, substrate-binding protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb21273: Predicted adenosine ABC transporter, substrate-binding protein
 
Xanthobacter autotrophicus Py2
Predicted adenosine ABC transporter, substrate-binding protein
aduB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4422: Predicted adenosine ABC transporter, permease component 1
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH03416: Predicted adenosine ABC transporter, permease component 1
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3879: Predicted adenosine ABC transporter, permease component 1
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb21274: Predicted adenosine ABC transporter, permease component 1
 
Xanthobacter autotrophicus Py2
Predicted adenosine ABC transporter, permease component 1
aduC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4423: Predicted adenosine ABC transporter, permease component 2
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH03417: Predicted adenosine ABC transporter, permease component 2
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3880: Predicted adenosine ABC transporter, permease component 2
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb21275: Predicted adenosine ABC transporter, permease component 2
 
Xanthobacter autotrophicus Py2
Predicted adenosine ABC transporter, permease component 2
aduD
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4424: Predicted adenosine ABC transporter, ATP-binding protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH03418: Predicted adenosine ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3881: Predicted adenosine ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Predicted adenosine ABC transporter, ATP-binding protein
aduH
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4425: putative Adenosine hydrolase (EC 3.2.2.1)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH03419: putative Adenosine hydrolase (EC 3.2.2.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3882: putative Adenosine hydrolase (EC 3.2.2.1)
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb21277: putative Adenosine hydrolase (EC 3.2.2.1)
 
Xanthobacter autotrophicus Py2
putative Adenosine hydrolase (EC 3.2.2.1)
ade
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4426: Adenine deaminase (EC 3.5.4.2)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH03420: Adenine deaminase (EC 3.5.4.2)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3883: Adenine deaminase (EC 3.5.4.2)
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb21278: Adenine deaminase (EC 3.5.4.2)
 
Xanthobacter autotrophicus Py2
Adenine deaminase (EC 3.5.4.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD