Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15
Caulobacter segnis ATCC 21756
Caulobacter sp. K31 2 1
Phenylobacterium zucineum HLK1 11 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -34
score = 6.47825
sequence = ATCCTCTAGTGGCTAGAGGAT

Gene: Caul_2301: Co/Zn/Cd efflux protein
*2
Phenylobacterium zucineum HLK1

Site:
position = -103
score = 6.47825
sequence = ATCCTCTAGCGACTAGAGGAT

Gene: PHZ_c1429: Co/Zn/Cd efflux protein

Site:
position = -19
score = 5.6668
sequence = ATCCTCTACCTACTAGAGGAT

Gene: PHZ_p0236: Co/Zn/Cd efflux protein
Co/Zn/Cd efflux protein
CC2720
 
Caulobacter crescentus CB15

Gene: CC2720: hypothetical protein
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_2293: hypothetical protein
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1430: hypothetical protein
hypothetical protein
czcC
 
Caulobacter crescentus CB15

Gene: CC2721: Heavy metal efflux RND outer membrane protein
 2
Caulobacter segnis ATCC 21756

Gene: Cseg_2387: Heavy metal efflux RND outer membrane protein

Gene: Cseg_2511: Heavy metal efflux RND outer membrane protein
 2
Caulobacter sp. K31

Gene: Caul_2294: Heavy metal efflux RND outer membrane protein

Gene: Caul_2284: Heavy metal efflux RND outer membrane protein
 3
Phenylobacterium zucineum HLK1

Gene: PHZ_p0238: Heavy metal efflux RND outer membrane protein

Gene: PHZ_c1431: Heavy metal efflux RND outer membrane protein

Gene: PHZ_p0254: Heavy metal efflux RND outer membrane protein
Heavy metal efflux RND outer membrane protein
czcB
 
Caulobacter crescentus CB15

Gene: CC2722: Heavy metal efflux RND transporter, membrane fusion protein
 2
Caulobacter segnis ATCC 21756

Gene: Cseg_2388: Heavy metal efflux RND transporter, membrane fusion protein

Gene: Cseg_2512: Heavy metal efflux RND transporter, membrane fusion protein
 2
Caulobacter sp. K31

Gene: Caul_2295: Heavy metal efflux RND transporter, membrane fusion protein

Gene: Caul_2285: Heavy metal efflux RND transporter, membrane fusion protein
 3
Phenylobacterium zucineum HLK1

Gene: PHZ_c1432: Heavy metal efflux RND transporter, membrane fusion protein

Gene: PHZ_p0239: Heavy metal efflux RND transporter, membrane fusion protein

Gene: PHZ_p0255: Heavy metal efflux RND transporter, membrane fusion protein
Heavy metal efflux RND transporter, membrane fusion protein
czcA
 
Caulobacter crescentus CB15

Gene: CC2724: Heavy metal efflux RND transmembrane protein
 2
Caulobacter segnis ATCC 21756

Gene: Cseg_2389: Heavy metal efflux RND transmembrane protein

Gene: Cseg_2513: Heavy metal efflux RND transmembrane protein
 2
Caulobacter sp. K31

Gene: Caul_2297: Heavy metal efflux RND transmembrane protein

Gene: Caul_2286: Heavy metal efflux RND transmembrane protein
 3
Phenylobacterium zucineum HLK1

Gene: PHZ_c1433: Heavy metal efflux RND transmembrane protein

Gene: PHZ_p0240: Heavy metal efflux RND transmembrane protein

Gene: PHZ_p0256: Heavy metal efflux RND transmembrane protein
Heavy metal efflux RND transmembrane protein
czcD2
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
 2
Phenylobacterium zucineum HLK1

Gene: PHZ_c1434: Co/Zn/Cd efflux protein

Gene: PHZ_p0262: Co/Zn/Cd efflux protein
Co/Zn/Cd efflux protein
Caul_2283
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_2283: hypothetical protein
 
Phenylobacterium zucineum HLK1

Gene: PHZ_p0237: Heavy metal RND efflux outer membrane protein, CzcC family
hypothetical protein
pbrT
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_2302: Pb(II) uptake protein, ILT family
 
Phenylobacterium zucineum HLK1
Pb(II) uptake protein, ILT family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD