Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594 2 1
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444 2 1
Sphingopyxis alaskensis RB2256 8 2
Sphingobium japonicum UT26S 12 1
Sphingomonas wittichii RW1
Zymomonas mobilis subsp. mobilis ZM4 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD
*
Erythrobacter litoralis HTCC2594

Site:
position = -37
score = 5.71289
sequence = ATCCTCCAGTAACTGGAGATT

Gene: ELI_04460: Co/Zn/Cd efflux protein
 
Erythrobacter sp. NAP1
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -63
score = 4.61132
sequence = ACCCTGTAGTTGCTACAGGGT

Gene: Saro_2151: Co/Zn/Cd efflux protein
*2
Sphingopyxis alaskensis RB2256

Site:
position = -19
score = 6.19031
sequence = ATCCTCCAGTGACTGGAGGAT

Gene: Sala_2444: Co/Zn/Cd efflux protein

Site:
position = -34
score = 5.36969
sequence = CTTCTACAGTTACTGGAGGTT

Gene: Sala_2560: Co/Zn/Cd efflux protein
*
Sphingobium japonicum UT26S

Site:
position = -35
score = 5.29693
sequence = CTTCTACAGCGACTGGAGGTG

Gene: SJA_C1-05430: Co/Zn/Cd efflux protein
 
Sphingomonas wittichii RW1
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -60
score = 5.01916
sequence = ACCCTATAGTAACTATAGACT

Gene: ZMO0204: Co/Zn/Cd efflux protein
Co/Zn/Cd efflux protein
pbrT
 
Erythrobacter litoralis HTCC2594

Gene: ELI_04455: Pb(II) uptake protein, ILT family
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2561: Pb(II) uptake protein, ILT family
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05420: Pb(II) uptake protein, ILT family
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Pb(II) uptake protein, ILT family
Sala_2566
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_03495: hypothetical protein
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2566: hypothetical protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05410: hypothetical protein
 2
Sphingomonas wittichii RW1

Gene: Swit_2610: hypothetical protein

Gene: Swit_5113: hypothetical protein
 
Zymomonas mobilis subsp. mobilis ZM4
hypothetical protein
czcC
 
Erythrobacter litoralis HTCC2594

Gene: ELI_04445: Heavy metal efflux RND outer membrane protein
 
Erythrobacter sp. NAP1

Gene: NAP1_03500: Heavy metal efflux RND outer membrane protein
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2148: Heavy metal efflux RND outer membrane protein
 3
Sphingopyxis alaskensis RB2256

Gene: Sala_2567: Heavy metal efflux RND outer membrane protein

Gene: Sala_2577: Heavy metal efflux RND outer membrane protein

Gene: Sala_2447: Heavy metal efflux RND outer membrane protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05400: Heavy metal efflux RND outer membrane protein
 2
Sphingomonas wittichii RW1

Gene: Swit_2609: Heavy metal efflux RND outer membrane protein

Gene: Swit_5400: Heavy metal efflux RND outer membrane protein
 
Zymomonas mobilis subsp. mobilis ZM4
Heavy metal efflux RND outer membrane protein
czcB
 
Erythrobacter litoralis HTCC2594

Gene: ELI_04440: Heavy metal efflux RND transporter, membrane fusion protein
 
Erythrobacter sp. NAP1

Gene: NAP1_03505: Heavy metal efflux RND transporter, membrane fusion protein
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2147: Heavy metal efflux RND transporter, membrane fusion protein
 3
Sphingopyxis alaskensis RB2256

Gene: Sala_2568: Heavy metal efflux RND transporter, membrane fusion protein

Gene: Sala_2578: Heavy metal efflux RND transporter, membrane fusion protein

Gene: Sala_2448: Heavy metal efflux RND transporter, membrane fusion protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05390: Heavy metal efflux RND transporter, membrane fusion protein
 
Sphingomonas wittichii RW1

Gene: Swit_2608: Heavy metal efflux RND transporter, membrane fusion protein
 
Zymomonas mobilis subsp. mobilis ZM4
Heavy metal efflux RND transporter, membrane fusion protein
czcA
 
Erythrobacter litoralis HTCC2594

Gene: ELI_04435: Heavy metal efflux RND transmembrane protein
 
Erythrobacter sp. NAP1

Gene: NAP1_03510: Heavy metal efflux RND transmembrane protein
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2146: Heavy metal efflux RND transmembrane protein
 3
Sphingopyxis alaskensis RB2256

Gene: Sala_2569: Heavy metal efflux RND transmembrane protein

Gene: Sala_2579: Heavy metal efflux RND transmembrane protein

Gene: Sala_2449: Heavy metal efflux RND transmembrane protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05380: Heavy metal efflux RND transmembrane protein
 
Sphingomonas wittichii RW1

Gene: Swit_2607: Heavy metal efflux RND transmembrane protein
 
Zymomonas mobilis subsp. mobilis ZM4
Heavy metal efflux RND transmembrane protein
Sala_2581
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2581: hypothetical protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05370: hypothetical protein
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
hypothetical protein
SJA_C1-05360
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05360: hypothetical protein
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
hypothetical protein
SJA_C1-05350
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05350: hypothetical protein
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
hypothetical protein
PF02535
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05340: Putative metal transporter
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Putative metal transporter
czcD2
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05330: Co/Zn/Cd efflux protein
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Co/Zn/Cd efflux protein
cadA
 
Erythrobacter litoralis HTCC2594

Gene: ELI_04425: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Erythrobacter sp. NAP1

Gene: NAP1_03515: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2145: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2582: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Sphingobium japonicum UT26S

Gene: SJA_C1-05320: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
ELI_04390
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2150: hypothetical protein
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2445: hypothetical protein
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
hypothetical protein
Sala_2446
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2446: hypothetical protein
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD