Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170 1 1
Magnetospirillum magnetotacticum MS-1 2 1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510 1 1
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1698: Co/Zn/Cd efflux protein
*2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007547: Co/Zn/Cd efflux protein

Site:
position = -192
score = 5.68532
sequence = AACCTCCAGTGACTGGAGATC

Gene: Magn03007548: Co/Zn/Cd efflux protein
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW

Gene: RC1_3841: Co/Zn/Cd efflux protein
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Co/Zn/Cd efflux protein
 
CRON 2.
cadA
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -66
score = 6.21905
sequence = ATCCTCTAGTCGCTAGAGATT

Gene: Rru_A1027: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
*
Azospirillum sp. B510

Site:
position = -58
score = 6.04791
sequence = ATCCTCCAGTCGCTAGAGAAT

Gene: AZL_a07690: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD