Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1 1 1
Paracoccus denitrificans PD1222 2 2
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654 8 5
Oceanicola granulosus HTCC2516 1 1
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597 13 6
Roseovarius nubinhibens ISM 6 4
Roseovarius sp. 217 6 5
Sulfitobacter sp. EE-36 3 1
Silicibacter TM1040 1 1
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193 9 5
Hyphomonas neptunium ATCC 15444 2 1
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF01841
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -78
score = 5.12465
sequence = AAGCTACAGTGACTGTAGCAA

Gene: RB2654_22408: Transglutaminase-like protein
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
*
Oceanicola batsensis HTCC2597

Site:
position = -57
score = 5.12465
sequence = AAGCTACAGTGACTGTAGCAA

Gene: OB2597_16652: Transglutaminase-like protein
*
Roseovarius nubinhibens ISM

Site:
position = -64
score = 5.59608
sequence = AAGCTATAGTGACTATAGCAA

Gene: ISM_17525: Transglutaminase-like protein
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
*
Roseobacter sp. MED193

Site:
position = -57
score = 4.87793
sequence = AAGCTACAGTAACTATAGAGA

Gene: MED193_02255: Transglutaminase-like protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Transglutaminase-like protein
czcD2
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
*2
Rhodobacterales bacterium HTCC2654

Gene: RB2654_22413: Co/Zn/Cd efflux protein

Site:
position = -50
score = 6.27327
sequence = AACCTCTAGTCGCTAGAGGAA

Gene: RB2654_10329: Co/Zn/Cd efflux protein
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_16657: Co/Zn/Cd efflux protein
 
Roseovarius nubinhibens ISM

Gene: ISM_17520: Co/Zn/Cd efflux protein
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_02260: Co/Zn/Cd efflux protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Co/Zn/Cd efflux protein
PF11964
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_22418: hypothetical protein
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_16662: hypothetical protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
 
CRON 2.
cadR
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -119
score = 5.72403
sequence = ATCCTCTAGCTACTGTAGGTT

Gene: RB2654_22398: Cadmium resistance transcriptional regulator, MerR family
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
*
Oceanicola batsensis HTCC2597

Site:
position = -134
score = 5.72403
sequence = ATCCTCTAGCTACTGTAGGTT

Gene: OB2597_16642: Cadmium resistance transcriptional regulator, MerR family
*
Roseovarius nubinhibens ISM

Site:
position = -129
score = 6.01198
sequence = ATCCTCTAGCAGCTAGAGGTT

Gene: ISM_17535: Cadmium resistance transcriptional regulator, MerR family
*
Roseovarius sp. 217

Site:
position = -135
score = 5.72403
sequence = ATCCTCTAGCTACTGTAGGTT

Gene: ROS217_02950: Cadmium resistance transcriptional regulator, MerR family
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
*
Roseobacter sp. MED193

Site:
position = -117
score = 6.19546
sequence = ATCCTCTAGCTACTAGAGGTT

Gene: MED193_02240: Cadmium resistance transcriptional regulator, MerR family
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Cadmium resistance transcriptional regulator, MerR family
PF02694
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_02245: Protein of unknown function UPF0060
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Protein of unknown function UPF0060
czcD
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_22403: Co/Zn/Cd efflux protein
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 2
Oceanicola batsensis HTCC2597

Gene: OB2597_16707: Co/Zn/Cd efflux protein

Gene: OB2597_16647: Co/Zn/Cd efflux protein
 
Roseovarius nubinhibens ISM

Gene: ISM_17530: Co/Zn/Cd efflux protein
*2
Roseovarius sp. 217

Site:
position = -128
score = 5.80329
sequence = AAGCTCTAGTCACTAGAGAGA

Gene: ROS217_13921: Co/Zn/Cd efflux protein

Gene: ROS217_02945: Co/Zn/Cd efflux protein
 
Sulfitobacter sp. EE-36
*
Silicibacter TM1040

Site:
position = -71
score = 6.26213
sequence = AACCTCTAGTCACTAGAGCAA

Gene: TM1040_2930: Co/Zn/Cd efflux protein
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_02250: Co/Zn/Cd efflux protein
*
Hyphomonas neptunium ATCC 15444

Site:
position = -53
score = 5.88338
sequence = ATCCTCTAGTTACTTGAGGAT

Gene: HNE_1727: Co/Zn/Cd efflux protein
 
Oceanicaulis alexandrii HTCC2633
Co/Zn/Cd efflux protein
lspA
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_16702: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1728: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Oceanicaulis alexandrii HTCC2633
Lipoprotein signal peptidase (EC 3.4.23.36)
 
CRON 3.
cadR2
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
*
Oceanicola batsensis HTCC2597

Site:
position = -124
score = 5.08982
sequence = AAGCTACAGTGGGTAGAGGTT

Gene: OB2597_05245: Cadmium resistance transcriptional regulator, MerR family
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Cadmium resistance transcriptional regulator, MerR family
PF02694
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05250: Protein of unknown function UPF0060
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Protein of unknown function UPF0060
PF01841
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
*
Oceanicola batsensis HTCC2597

Site:
position = -45
score = 4.94116
sequence = AAGCTACAGTCGCTGTAGCAA

Gene: OB2597_05255: Transglutaminase-like protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Transglutaminase-like protein
czcD3
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05260: Co/Zn/Cd efflux protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Co/Zn/Cd efflux protein
 
CRON 4.
EE36_00940
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
*
Sulfitobacter sp. EE-36

Site:
position = -61
score = 4.81219
sequence = AAGCTACAGTTGCTGTAGGTC

Gene: EE36_00940: cation-transporting P-type ATPase
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
cation-transporting P-type ATPase
cadA
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -70
score = 5.13063
sequence = AACCTATAGTTGCTAGAGACA

Gene: RSP_1791: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*2
Paracoccus denitrificans PD1222

Site:
position = -37
score = 5.75504
sequence = AACCTCTAGTTGCTAGAGATC

Gene: Pden_0212: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -75
score = 6.07865
sequence = AAGCTCTAGTCGCTAGAGGAA

Gene: Pden_2344: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -228
score = 5.34119
sequence = AAGCTCTAGTTACTGTAGGGG

Gene: RB2654_22328: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Oceanicola granulosus HTCC2516

Site:
position = -63
score = 5.10322
sequence = AACCTACAGTCGGTAGAGGTC

Gene: OG2516_17805: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Loktanella vestfoldensis SKA53
*2
Oceanicola batsensis HTCC2597

Site:
position = -228
score = 5.34119
sequence = AAGCTCTAGTTACTGTAGGGG

Gene: OB2597_16572: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -62
score = 5.00681
sequence = AACCTACAGTTGCTGTAGGTC

Gene: OB2597_05215: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Roseovarius nubinhibens ISM

Site:
position = -201
score = 5.1577
sequence = AAGCTCTAGCTACTGTAGGGG

Gene: ISM_17615: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Roseovarius sp. 217

Site:
position = -271
score = 5.34119
sequence = AAGCTCTAGTTACTGTAGGGG

Gene: ROS217_03080: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Sulfitobacter sp. EE-36

Gene: EE36_00945: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
*2
Roseobacter sp. MED193

Site:
position = -60
score = 5.1577
sequence = AAGCTCTAGCTACTGTAGGGG

Gene: MED193_02180: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -58
score = 5.87994
sequence = AACCTCTAGTCACTGTAGGTC

Gene: MED193_15017: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
copG
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05210: Predicted metal binding protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_00950: Predicted metal binding protein
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted metal binding protein
cadR2
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_15022: Cadmium resistance transcriptional regulator, MerR family
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Cadmium resistance transcriptional regulator, MerR family
 
CRON 5.
PF03734
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -150
score = 5.29212
sequence = AACCTCTAGTAGCTTTAGGAG

Gene: RB2654_22323: hypothetical protein
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
*
Oceanicola batsensis HTCC2597

Site:
position = -150
score = 5.29212
sequence = AACCTCTAGTAGCTTTAGGAG

Gene: OB2597_16567: hypothetical protein
*
Roseovarius nubinhibens ISM

Site:
position = -152
score = 5.57465
sequence = AACCTCTAGCCACTAGAAGTC

Gene: ISM_17625: hypothetical protein
*3
Roseovarius sp. 217

Site:
position = -111
score = 5.34303
sequence = AAGCTCTAGTTGGTAGAGGTT

Gene: ROS217_02920: hypothetical protein

Gene: ROS217_03090: hypothetical protein

Site:
position = -60
score = 5.14431
sequence = AAGCTCTAGTGGGTGGAGGTC

Gene: ROS217_02925: hypothetical protein
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
*
Roseobacter sp. MED193

Site:
position = -88
score = 5.57465
sequence = AACCTCTAGCCACTAGAAGTC

Gene: MED193_02170: hypothetical protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD