Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 1 1
Rhizobium sp. NGR234 1 1
Rhizobium leguminosarum bv. viciae 3841 1 1
Rhizobium etli CFN 42 1 1
Agrobacterium tumefaciens str. C58 (Cereon) 4 2
Mesorhizobium sp. BNC1 7 4
Mesorhizobium loti MAFF303099 1 1
Brucella melitensis 16M 1 1
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009 1 1
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1 1 1
Nitrobacter winogradskyi Nb-255 1 1
Azorhizobium caulinodans ORS 571 1 1
Xanthobacter autotrophicus Py2 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cadA2
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -57
score = 5.33082
sequence = ACCCTCTAGCTGCTATAGGTC

Gene: Meso_4129: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
CRON 2.
cadA
*
Sinorhizobium meliloti 1021

Site:
position = -54
score = 6.04897
sequence = AACCTCTAGCCGCTAGAGGAC

Gene: SMc04128: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Rhizobium sp. NGR234

Site:
position = -54
score = 6.01407
sequence = TAGCTCTAGTCGCTAGAGGTT

Gene: NGR_c34490: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -58
score = 6.30619
sequence = CACCTCTAGTCGCTAGAGGAT

Gene: RL4262: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Rhizobium etli CFN 42

Site:
position = -58
score = 6.30619
sequence = CACCTCTAGTCGCTAGAGGAT

Gene: RHE_CH03719: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -59
score = 5.82877
sequence = AAGCTCTAGTTGCTAGAGGTG

Gene: Atu0843: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Mesorhizobium sp. BNC1

Site:
position = -57
score = 6.17812
sequence = CTCCTATAGTCACTAGAGGAA

Gene: Meso_2849: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Mesorhizobium loti MAFF303099

Site:
position = -97
score = 6.06751
sequence = AAGCTCTAGTGACTAGAGCAA

Gene: mll2475: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Brucella melitensis 16M

Site:
position = -63
score = 6.33603
sequence = CTCCTCTAGTTACTAGAGGAT

Gene: BMEI0053: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -59
score = 4.64605
sequence = ACCCTGTAGCCGCTACAGGGT

Gene: RPA3260: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -46
score = 6.18954
sequence = CTCCTCTAGCGACTAGAGGAC

Gene: BBta_7421: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Nitrobacter winogradskyi Nb-255

Site:
position = -59
score = 5.11923
sequence = ACCCTATAGTTACTACAGGGT

Gene: Nwi_3134: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Azorhizobium caulinodans ORS 571

Site:
position = -55
score = 6.37302
sequence = CTCCTCTAGTGACTAGAGGAC

Gene: AZC_1456: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*2
Xanthobacter autotrophicus Py2

Site:
position = -28
score = 6.03519
sequence = CTCCTCTAGTGACTAGAGTAT

Gene: Xaut_3978: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -28
score = 6.03519
sequence = CTCCTCTAGTGACTAGAGTAT

Gene: Xaut_3338: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
CRON 3.
cadR2
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -34
score = 5.13025
sequence = ATGCTTTAGTCGCCAGAGGAT

Gene: Meso_4426: Cadmium resistance transcriptional regulator, MerR family
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Cadmium resistance transcriptional regulator, MerR family
Meso_4425
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_4425: hypothetical protein
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
hypothetical protein
czcD
 
Sinorhizobium meliloti 1021

Gene: SMc04167: Co/Zn/Cd efflux protein
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1351: Co/Zn/Cd efflux protein
 
Rhizobium etli CFN 42

Gene: RHE_CH01219: Co/Zn/Cd efflux protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0891: Co/Zn/Cd efflux protein
 3
Mesorhizobium sp. BNC1

Gene: Meso_0755: Co/Zn/Cd efflux protein

Gene: Meso_4214: Co/Zn/Cd efflux protein

Gene: Meso_4424: Co/Zn/Cd efflux protein
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bll5050: Co/Zn/Cd efflux protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4663: Co/Zn/Cd efflux protein
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Co/Zn/Cd efflux protein
Atu0889
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -20
score = 5.23699
sequence = TATCTCCAGTCTCTAGAGATA

Gene: Atu0889: hypothetical protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
hypothetical protein
PF02583
 
Sinorhizobium meliloti 1021

Gene: SMc04168: hypothetical protein
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1350: hypothetical protein
 
Rhizobium etli CFN 42

Gene: RHE_CH01218: hypothetical protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0890: hypothetical protein
 
Mesorhizobium sp. BNC1

Gene: Meso_0756: hypothetical protein
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
hypothetical protein
PF00501
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -64
score = 4.4297
sequence = ATTCTGTAGTGGCCACAGGAA

Site:
position = -280
score = 4.96872
sequence = ATTCTTTAGTGGCTACAGAAT

Gene: Meso_4216: Coenzyme F390 synthetase
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Coenzyme F390 synthetase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD