Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1
Thauera sp. MZ1T 2 2
Dechloromonas aromatica RCB 3 2
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans
Chromobacterium violaceum ATCC 12472 1 1
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9 1 1
Methylobacillus flagellatus KT 1 1
Methylotenera mobilis JLW8
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
*
Methylobacillus flagellatus KT

Site:
position = -16
score = 5.34584
sequence = ACCCTCTAGTAACTTGATGGT

Gene: Mfla_0694: Co/Zn/Cd efflux protein
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Co/Zn/Cd efflux protein
 
CRON 2.
cadA
 
Azoarcus sp. EbN1
*2
Thauera sp. MZ1T

Site:
position = -57
score = 5.3799
sequence = ACTCTGTAGTGACTACGGATT

Gene: Tmz1t_2103: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -57
score = 5.3799
sequence = ACTCTGTAGTGACTACGGATT

Gene: Tmz1t_2390: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*2
Dechloromonas aromatica RCB

Site:
position = -58
score = 6.52076
sequence = ACCCTATAGTAGCTACAGGGT

Gene: Daro_2257: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -49
score = 5.63405
sequence = ACTCTGTAGCCACTCAAGGGT

Gene: Daro_2631: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -154
score = 6.70483
sequence = ACCCTGTAGTGACTACAGGGT

Gene: CV1154: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -48
score = 6.24161
sequence = ACCCTATAGTAGCTCCAGGGT

Gene: LHK_00449: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB

Gene: Daro_2630: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Lipoprotein signal peptidase (EC 3.4.23.36)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD