Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 1 1
Acidovorax sp. JS42 9 5
Comamonas testosteroni KF-1 7 5
Delftia acidovorans SPH-1 3 2
Polaromonas naphthalenivorans CJ2 1 1
Polaromonas sp. JS666 1 1
Rhodoferax ferrireducens DSM 15236 1 1
Variovorax paradoxus S110 1 1
Verminephrobacter eiseniae EF01-2 2 2
Methylibium petroleiphilum PM1 6 2
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cadA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -54
score = 5.73069
sequence = ACTCTATACCTACTATAGGGT

Gene: Rfer_0854: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
CRON 2.
cadA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -150
score = 4.73255
sequence = ACTCTCAATCTGCTTTAGGGT

Gene: CtesDRAFT_1793: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Delftia acidovorans SPH-1

Site:
position = -274
score = 5.73634
sequence = ACCTTGGAGCTACTCCAAGGT

Gene: Daci_0479: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1792: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Delftia acidovorans SPH-1

Gene: Daci_0480: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lipoprotein signal peptidase (EC 3.4.23.36)
 
CRON 3.
cadA
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -61
score = 6.29717
sequence = ACTCTATAGTAACTATAGAGT

Gene: Ajs_1242: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Comamonas testosteroni KF-1

Site:
position = -61
score = 6.30565
sequence = ACTCTATAGTAGCTATAGGGT

Gene: CtesDRAFT_2650: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_1243: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2649: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lipoprotein signal peptidase (EC 3.4.23.36)
 
CRON 4.
pbrT
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_1240: Pb(II) uptake protein, ILT family
 2
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1706: Pb(II) uptake protein, ILT family

Gene: CtesDRAFT_1790: Pb(II) uptake protein, ILT family
 
Delftia acidovorans SPH-1

Gene: Daci_0482: Pb(II) uptake protein, ILT family
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
*
Methylibium petroleiphilum PM1

Site:
position = -78
score = 5.38839
sequence = ACCCTGTAGTGGCTACGGACT

Gene: Mpe_A2353: Pb(II) uptake protein, ILT family
 
Leptothrix cholodnii SP-6
Pb(II) uptake protein, ILT family
PF04116
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2354: Sterol desaturase
 
Leptothrix cholodnii SP-6
Sterol desaturase
czcD
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2355: Co/Zn/Cd efflux protein
 
Leptothrix cholodnii SP-6
Co/Zn/Cd efflux protein
czcC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2356: Heavy metal efflux RND outer membrane protein
 
Leptothrix cholodnii SP-6
Heavy metal efflux RND outer membrane protein
pbrR
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -54
score = 6.29717
sequence = ACTCTATAGTTACTATAGAGT

Gene: Ajs_1241: Lead resistance transcriptional regulator, MerR family
*
Comamonas testosteroni KF-1

Site:
position = -44
score = 6.30565
sequence = ACCCTATAGCTACTATAGAGT

Gene: CtesDRAFT_2651: Lead resistance transcriptional regulator, MerR family
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lead resistance transcriptional regulator, MerR family
 
CRON 5.
cadA
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -34
score = 5.49138
sequence = ACTCTATACCCACTTCAGGGT

Gene: Ajs_1335: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Comamonas testosteroni KF-1

Site:
position = -55
score = 5.79306
sequence = ACTCTATACCAACTACAGGGT

Gene: CtesDRAFT_1695: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Delftia acidovorans SPH-1
*
Polaromonas naphthalenivorans CJ2

Site:
position = -50
score = 4.92512
sequence = ACCTTCAAGTGGGTTCAGGGT

Gene: Pnap_4001: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -26
score = 4.82998
sequence = ACTCTACACCTGCTTCAGGGT

Gene: Vapar_3562: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
PF01841
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_1334: Transglutaminase-like protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Transglutaminase-like protein
 
CRON 6.
cadA
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -328
score = 5.21158
sequence = ACCTTGAAGCGGCTTGAAGGT

Gene: Aave_1815: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Acidovorax sp. JS42

Site:
position = -34
score = 5.7138
sequence = ACCTTGGAGTGGCTTCAAGGT

Gene: Ajs_2594: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Comamonas testosteroni KF-1

Site:
position = -34
score = 5.02186
sequence = ACCTTGAAGTGACTTTATTGT

Gene: CtesDRAFT_0050: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Delftia acidovorans SPH-1

Site:
position = -34
score = 4.94754
sequence = ACCTTGAAGTGACTTCACCGT

Gene: Daci_2915: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
CRON 7.
czcD
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -61
score = 5.24334
sequence = ACATTATAGCTACTATATAGT

Gene: Ajs_3474: Co/Zn/Cd efflux protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -60
score = 5.28308
sequence = ACCTTGAAGTGGGTCCAGGGT

Gene: Bpro_3481: Co/Zn/Cd efflux protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
*2
Verminephrobacter eiseniae EF01-2

Site:
position = -57
score = 6.24161
sequence = ACCCTAGAGTTGCTACAGGGT

Gene: Veis_2983: Co/Zn/Cd efflux protein

Site:
position = -68
score = 4.68292
sequence = ACCATCGATCGACTCCAGGGT

Gene: Veis_1666: Co/Zn/Cd efflux protein
*
Methylibium petroleiphilum PM1

Site:
position = -55
score = 6.00699
sequence = ACTCTGGAGCAGCTACAGGGT

Gene: Mpe_A1655: Co/Zn/Cd efflux protein
 
Leptothrix cholodnii SP-6
Co/Zn/Cd efflux protein
lspA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3473: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Lipoprotein signal peptidase (EC 3.4.23.36)
PF01841
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1654: Transglutaminase-like protein
 
Leptothrix cholodnii SP-6
Transglutaminase-like protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD