Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 1 1
Burkholderia mallei ATCC 23344 1 1
Burkholderia sp. 383 1 1
Burkholderia cepacia AMMD 1 1
Burkholderia vietnamiensis G4 1 1
Burkholderia glumae BGR1 1 1
Burkholderia xenovorans LB400 21 8
Burkholderia phymatum STM815
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cadA
*
Burkholderia pseudomallei K96243

Site:
position = -57
score = 6.41634
sequence = ACCTTGTAGTGACTACAAGGT

Gene: BPSL3378: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Burkholderia mallei ATCC 23344

Site:
position = -414
score = 6.41634
sequence = ACCTTGTAGTGACTACAAGGT

Gene: BMA2976: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Burkholderia sp. 383

Site:
position = -57
score = 6.13719
sequence = ACCTTGTAGTGGCTTCAGGGT

Gene: Bcep18194_A3304: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Burkholderia cepacia AMMD

Site:
position = -622
score = 6.13719
sequence = ACCTTGTAGTGGCTTCAGGGT

Gene: Bamb_0114: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Burkholderia vietnamiensis G4

Site:
position = -517
score = 6.13719
sequence = ACCTTGTAGTGGCTTCAGGGT

Gene: Bcep1808_0131: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Burkholderia glumae BGR1

Site:
position = -57
score = 5.85805
sequence = ACCTTGAAGTGGCTTCAGGGT

Gene: bglu_1g00910: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Burkholderia xenovorans LB400

Site:
position = -353
score = 5.99294
sequence = ACCTTGTAGTGGCTTCAAGGT

Gene: Bxe_A4439: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Burkholderia phymatum STM815
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
CRON 2.
czcD
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
*7
Burkholderia xenovorans LB400

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Bxe_B2911: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Bxe_C0883: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Bxe_B1605: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Bxe_C0391: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Bxe_A1118: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Bxe_A2903: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Bxe_A1104: Co/Zn/Cd efflux protein
 
Burkholderia phymatum STM815
Co/Zn/Cd efflux protein
lspA
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 7
Burkholderia xenovorans LB400

Gene: Bxe_B1606: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Bxe_B2910: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Bxe_C0884: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Bxe_C0390: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Bxe_A1119: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Bxe_A2904: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Bxe_A1105: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Burkholderia phymatum STM815
Lipoprotein signal peptidase (EC 3.4.23.36)
tnpA
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 6
Burkholderia xenovorans LB400

Gene: Bxe_B1607: Transposase

Gene: Bxe_C0389: Transposase

Gene: Bxe_B2909: Transposase

Gene: Bxe_C0885: Transposase

Gene: Bxe_A2905: Transposase

Gene: Bxe_A1106: Transposase
 
Burkholderia phymatum STM815
Transposase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD