Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1 1 1
Acinetobacter baumannii AB0057 3 2
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD2
 
Acinetobacter sp. ADP1
*
Acinetobacter baumannii AB0057

Site:
position = -61
score = 5.24334
sequence = ACATTATAGCTACTATATAGT

Gene: AB57_0301: Co/Zn/Cd efflux protein
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Co/Zn/Cd efflux protein
lspA
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057

Gene: AB57_0302: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Lipoprotein signal peptidase (EC 3.4.23.36)
 
CRON 2.
czcD
*
Acinetobacter sp. ADP1

Site:
position = -51
score = 4.88949
sequence = ACCTTGGAGTGACTCCAGCCT

Gene: ACIAD3600: Co/Zn/Cd efflux protein
*
Acinetobacter baumannii AB0057

Site:
position = -57
score = 5.37744
sequence = ACTCTGGAGCTACTCAAGGGT

Gene: AB57_1125: Co/Zn/Cd efflux protein
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Co/Zn/Cd efflux protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD