Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 1 1
Pseudomonas entomophila L48 3 2
Pseudomonas putida KT2440 3 2
Pseudomonas syringae pv. tomato str. DC3000 1 1
Pseudomonas fluorescens Pf-5 2 1
Pseudomonas mendocina ymp 3 2
Pseudomonas stutzeri A1501 3 3
Azotobacter vinelandii AvOP 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcR
 
Pseudomonas aeruginosa PAO1

Gene: PA2523: DNA-binding heavy metal response regulator
*
Pseudomonas entomophila L48

Site:
position = -57
score = 5.14027
sequence = ACCCTGATACAGCTACAGGGT

Gene: PSEEN4285: DNA-binding heavy metal response regulator
*2
Pseudomonas putida KT2440

Site:
position = -56
score = 5.8445
sequence = ACCCTGATGTCACTACAGGGT

Gene: PP1438: DNA-binding heavy metal response regulator

Gene: PP0029: DNA-binding heavy metal response regulator
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0378: DNA-binding heavy metal response regulator
*
Pseudomonas fluorescens Pf-5

Site:
position = -71
score = 5.78683
sequence = ACCCTATAGCTACTACAGACT

Gene: PFL_3147: DNA-binding heavy metal response regulator
*
Pseudomonas mendocina ymp

Site:
position = -115
score = 6.29557
sequence = ACCCTGTAGTAACTACAGGGA

Gene: Pmen_1174: DNA-binding heavy metal response regulator
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
DNA-binding heavy metal response regulator
PF00512
 
Pseudomonas aeruginosa PAO1

Gene: PA2524: Heavy metal sensor histidine kinase
 
Pseudomonas entomophila L48

Gene: PSEEN4286: Heavy metal sensor histidine kinase
 2
Pseudomonas putida KT2440

Gene: PP1437: Heavy metal sensor histidine kinase

Gene: PP0030: Heavy metal sensor histidine kinase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0379: Heavy metal sensor histidine kinase
 
Pseudomonas fluorescens Pf-5

Gene: PFL_3148: Heavy metal sensor histidine kinase
 
Pseudomonas mendocina ymp

Gene: Pmen_1173: Heavy metal sensor histidine kinase
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Heavy metal sensor histidine kinase
 
CRON 2.
cadA
*
Pseudomonas aeruginosa PAO1

Site:
position = -60
score = 6.43039
sequence = ACTCTGTAGTTGCTACAGGGT

Gene: PA3690: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Pseudomonas entomophila L48

Site:
position = -163
score = 6.49822
sequence = ACCCTATAGTGGCTACAGGGT

Gene: PSEEN5232: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Pseudomonas putida KT2440

Site:
position = -58
score = 6.49822
sequence = ACCCTATAGTGGCTACAGGGT

Gene: PP5139: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -59
score = 6.49822
sequence = ACCCTATAGTGGCTACAGGGT

Gene: PSPTO5279: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5892: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Pseudomonas mendocina ymp

Site:
position = -57
score = 6.64247
sequence = ACCCTATAGTGACTACAGGGT

Gene: Pmen_4225: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Pseudomonas stutzeri A1501

Site:
position = -210
score = 6.21907
sequence = ACCCTGTAGTGGCTTTAGGGT

Gene: PST_0664: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Azotobacter vinelandii AvOP

Site:
position = -114
score = 6.25511
sequence = ACTCTGTAGTGGCTACAGAGT

Gene: Avin_18520: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
CRON 3.
czcD2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
*
Pseudomonas stutzeri A1501

Site:
position = -61
score = 5.94471
sequence = ACCTTGTAGTAGCTATAGGGC

Gene: PST_3416: Co/Zn/Cd efflux protein
 
Azotobacter vinelandii AvOP
Co/Zn/Cd efflux protein
 
CRON 4.
czcD
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
*
Pseudomonas stutzeri A1501

Site:
position = -57
score = 6.58312
sequence = ACCCTGTAGTTGCTACAGGGT

Gene: PST_1619: Co/Zn/Cd efflux protein
*
Azotobacter vinelandii AvOP

Site:
position = -58
score = 6.13719
sequence = ACCCTGAAGCCGCTACAGGGT

Gene: Avin_24510: Co/Zn/Cd efflux protein
Co/Zn/Cd efflux protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD