Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 1 1
Marinobacter aqueolei 13 7
Marinobacter sp. ELB17 1 1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92 1 1
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40 6 1
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107 5 1
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -57
score = 6.29717
sequence = ACTCTATAGTTACTATAGAGT

Gene: Sde_1960: Co/Zn/Cd efflux protein
 
Teredinibacter turnerae T7901
*
Cellvibrio japonicus Ueda107

Site:
position = -63
score = 6.1543
sequence = ACCCTCTAGTAACTATAGAGT

Gene: CJA_1839: Co/Zn/Cd efflux protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Co/Zn/Cd efflux protein
Sde_1959
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1959: hypothetical protein
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
hypothetical protein
czcC
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1958: Heavy metal efflux RND outer membrane protein
 
Teredinibacter turnerae T7901
 2
Cellvibrio japonicus Ueda107

Gene: CJA_1841: Heavy metal efflux RND outer membrane protein

Gene: CJA_3697: Heavy metal efflux RND outer membrane protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1379: Heavy metal efflux RND outer membrane protein
Heavy metal efflux RND outer membrane protein
Sde_1957
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1957: hypothetical protein
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
hypothetical protein
czcB
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1956: Heavy metal efflux RND transporter, membrane fusion protein
 
Teredinibacter turnerae T7901
 2
Cellvibrio japonicus Ueda107

Gene: CJA_1842: Heavy metal efflux RND transporter, membrane fusion protein

Gene: CJA_3696: Heavy metal efflux RND transporter, membrane fusion protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1378: Heavy metal efflux RND transporter, membrane fusion protein
Heavy metal efflux RND transporter, membrane fusion protein
czcA
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1955: Heavy metal efflux RND transmembrane protein
 
Teredinibacter turnerae T7901
 2
Cellvibrio japonicus Ueda107

Gene: CJA_1843: Heavy metal efflux RND transmembrane protein

Gene: CJA_3695: Heavy metal efflux RND transmembrane protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1377: Heavy metal efflux RND transmembrane protein
Heavy metal efflux RND transmembrane protein
CJA_1840
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_1840: hypothetical protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
hypothetical protein
 
CRON 2.
czcD
*
Hahella chejuensis KCTC 2396

Site:
position = -58
score = 5.54752
sequence = ACCCTGTAGCGACTCCAGACT

Gene: HCH_03680: Co/Zn/Cd efflux protein
*
Marinobacter aqueolei

Site:
position = -55
score = 6.58312
sequence = ACCCTGTAGCAACTACAGGGT

Gene: Maqu_3109: Co/Zn/Cd efflux protein
*
Marinobacter sp. ELB17

Site:
position = -57
score = 6.58312
sequence = ACCCTGTAGCTACTACAGGGT

Gene: MELB17_04522: Co/Zn/Cd efflux protein
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -59
score = 6.52076
sequence = ACCCTATAGCTACTACAGGGT

Gene: MED92_00235: Co/Zn/Cd efflux protein
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1006: Co/Zn/Cd efflux protein
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Co/Zn/Cd efflux protein
 
CRON 3.
czcD2
 
Hahella chejuensis KCTC 2396
*7
Marinobacter aqueolei

Gene: Maqu_0890: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.89667
sequence = ACCTTATAGTGACTATATAGT

Gene: Maqu_1408: Co/Zn/Cd efflux protein

Site:
position = -40
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Maqu_0893: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: Maqu_4003: Co/Zn/Cd efflux protein

Site:
position = -61
score = 6.56058
sequence = ACCCTGTAGTGGCTACAGGGT

Gene: Maqu_1294: Co/Zn/Cd efflux protein

Site:
position = -61
score = 6.56058
sequence = ACCCTGTAGTGGCTACAGGGT

Gene: Maqu_3210: Co/Zn/Cd efflux protein

Site:
position = -61
score = 6.56058
sequence = ACCCTGTAGTGGCTACAGGGT

Gene: Maqu_3273: Co/Zn/Cd efflux protein
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
*
Alcanivorax borkumensis SK2

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: ABO_1368: Co/Zn/Cd efflux protein
Co/Zn/Cd efflux protein
PF00665
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_0892: ISPsy14, transposase
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
ISPsy14, transposase
PF01695
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_0891: Transposase subunit
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Transposase subunit
lspA
 
Hahella chejuensis KCTC 2396
 3
Marinobacter aqueolei

Gene: Maqu_0889: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Maqu_1409: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Maqu_3274: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1369: Lipoprotein signal peptidase (EC 3.4.23.36)
Lipoprotein signal peptidase (EC 3.4.23.36)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD