Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 7 1
Alteromonas macleodii 'Deep ecotype'
Glaciecola sp. HTCC2999 6 1
Colwellia psychrerythraea 34H
Alteromonadales bacterium TW-7
Pseudoalteromonas haloplanktis TAC125 4 1
Pseudoalteromonas tunicata D2
Idiomarina baltica OS145 10 3
Idiomarina loihiensis L2TR 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD2
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: OS145_03978: Co/Zn/Cd efflux protein
*2
Idiomarina loihiensis L2TR

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: IL1242: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: IL0632: Co/Zn/Cd efflux protein
Co/Zn/Cd efflux protein
lspA2
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_03973: Lipoprotein signal peptidase (EC 3.4.23.36)
 2
Idiomarina loihiensis L2TR

Gene: IL1241: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: IL0633: Lipoprotein signal peptidase (EC 3.4.23.36)
Lipoprotein signal peptidase (EC 3.4.23.36)
 
CRON 2.
czcD
*2
Pseudoalteromonas atlantica T6c

Site:
position = -60
score = 4.56606
sequence = ACTCTATACTTAGTATAGACT

Gene: Patl_2025: Co/Zn/Cd efflux protein

Gene: Patl_2027: Co/Zn/Cd efflux protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02030: Co/Zn/Cd efflux protein
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100000545: Co/Zn/Cd efflux protein
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*2
Idiomarina baltica OS145

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: OS145_03758: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.49582
sequence = ACCTTATAGTAGCTTTATAGT

Gene: OS145_01757: Co/Zn/Cd efflux protein
*
Idiomarina loihiensis L2TR

Site:
position = -161
score = 5.64006
sequence = ACCTTATAGTAACTTTATAGT

Gene: IL1636: Co/Zn/Cd efflux protein
Co/Zn/Cd efflux protein
Patl_2026
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2026: hypothetical protein
 
Alteromonas macleodii 'Deep ecotype'
*
Glaciecola sp. HTCC2999

Site:
position = -78
score = 5.15573
sequence = ACCCTATACTTGGTATAGAGT

Gene: GHTCC_010100000540: hypothetical protein
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
Patl_2028
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2028: hypothetical protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02031: hypothetical protein
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100000550: hypothetical protein
 
Colwellia psychrerythraea 34H

Gene: CPS_2870: hypothetical protein
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
czcC
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2029: Heavy metal efflux RND outer membrane protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02027: Heavy metal efflux RND outer membrane protein
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100000555: Heavy metal efflux RND outer membrane protein
 
Colwellia psychrerythraea 34H

Gene: CPS_1957: Heavy metal efflux RND outer membrane protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_03857: Heavy metal efflux RND outer membrane protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa0577: Heavy metal efflux RND outer membrane protein
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_01742: Heavy metal efflux RND outer membrane protein
 2
Idiomarina loihiensis L2TR

Gene: IL0779: Heavy metal efflux RND outer membrane protein

Gene: IL1634: Heavy metal efflux RND outer membrane protein
Heavy metal efflux RND outer membrane protein
czcB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2030: Heavy metal efflux RND transporter, membrane fusion protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02028: Heavy metal efflux RND transporter, membrane fusion protein
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100000560: Heavy metal efflux RND transporter, membrane fusion protein
 
Colwellia psychrerythraea 34H

Gene: CPS_1958: Heavy metal efflux RND transporter, membrane fusion protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_03862: Heavy metal efflux RND transporter, membrane fusion protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa0578: Heavy metal efflux RND transporter, membrane fusion protein
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_01737: Heavy metal efflux RND transporter, membrane fusion protein
 2
Idiomarina loihiensis L2TR

Gene: IL0778: Heavy metal efflux RND transporter, membrane fusion protein

Gene: IL1633: Heavy metal efflux RND transporter, membrane fusion protein
Heavy metal efflux RND transporter, membrane fusion protein
czcA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2031: Heavy metal efflux RND transmembrane protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02029: Heavy metal efflux RND transmembrane protein
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100000565: Heavy metal efflux RND transmembrane protein
 
Colwellia psychrerythraea 34H

Gene: CPS_1959: Heavy metal efflux RND transmembrane protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_03867: Heavy metal efflux RND transmembrane protein
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa0579: Heavy metal efflux RND transmembrane protein
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_01732: Heavy metal efflux RND transmembrane protein
 2
Idiomarina loihiensis L2TR

Gene: IL0777: Heavy metal efflux RND transmembrane protein

Gene: IL1632: Heavy metal efflux RND transmembrane protein
Heavy metal efflux RND transmembrane protein
lspA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 2
Idiomarina baltica OS145

Gene: OS145_03763: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: OS145_01752: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Idiomarina loihiensis L2TR

Gene: IL1635: Lipoprotein signal peptidase (EC 3.4.23.36)
Lipoprotein signal peptidase (EC 3.4.23.36)
OS145_01747
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_01747: hypothetical protein
 
Idiomarina loihiensis L2TR

Gene: IL0780: hypothetical protein
hypothetical protein
ATW7_03852
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_03852: conserved protein of unknown function
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -93
score = 5.18325
sequence = ACCTTCCAGTAACTAGAAGGT

Gene: PSHAa0576: conserved protein of unknown function
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
conserved protein of unknown function
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD