Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20
Aggregatibacter aphrophilus NJ8700
Pasteurella multocida subsp. multocida str. Pm70 1 1
Mannheimia succiniciproducens MBEL55E 1 1
Actinobacillus succinogenes 130Z
Haemophilus somnus 2336 1 1
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
*2
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -63
score = 5.67555
sequence = ACCCTGTAATGACTACGGAGT

Gene: PM1942: Co/Zn/Cd efflux protein

Gene: PM1337: Co/Zn/Cd efflux protein
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -77
score = 5.25819
sequence = AGTCTGTAGTAGCTACGGAGT

Gene: MS1434: Co/Zn/Cd efflux protein
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1517: Co/Zn/Cd efflux protein
*
Haemophilus somnus 2336

Site:
position = -62
score = 5.67555
sequence = ACCCTGTAATGACTACGGAGT

Gene: HSM_1740: Co/Zn/Cd efflux protein
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -61
score = 5.67555
sequence = ACCCTGTAATGACTACGGAGT

Gene: HAPS_1831: Co/Zn/Cd efflux protein
Co/Zn/Cd efflux protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD