Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 1 1
Ralstonia pickettii 12J 10 6
Ralstonia metallidurans CH34 14 8
Ralstonia eutropha JMP134 2 2
Ralstonia eutropha H16 2 2
Cupriavidus taiwanensis 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cadR
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -30
score = 5.8573
sequence = ACCCTGTAATTACTACAGGGA

Gene: Rmet_3456: Cadmium resistance transcriptional regulator, MerR family
*
Ralstonia eutropha JMP134

Site:
position = -31
score = 5.68202
sequence = ACCCCGTAGTCACTACAGAGA

Gene: Reut_A3299: Cadmium resistance transcriptional regulator, MerR family
*
Ralstonia eutropha H16

Site:
position = -42
score = 6.14485
sequence = ACCCTGTAGTAGTTACAGGGT

Gene: H16_A3607: Cadmium resistance transcriptional regulator, MerR family
*
Cupriavidus taiwanensis

Site:
position = -39
score = 6.12231
sequence = ACCCTGTAGTCGTTACAGGGT

Gene: RALTA_A3062: Cadmium resistance transcriptional regulator, MerR family
Cadmium resistance transcriptional regulator, MerR family
 
CRON 2.
pbrA
 
Ralstonia solanacearum GMI1000
*2
Ralstonia pickettii 12J

Site:
position = -63
score = 6.15292
sequence = ACTCTATAGTAGCTATAGAGT

Gene: Rpic_1815: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -65
score = 6.15292
sequence = ACTCTATAGTAGCTATAGAGT

Gene: Rpic_1643: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*3
Ralstonia metallidurans CH34

Site:
position = -26
score = 4.85391
sequence = ACTCTATATCTACTAGAGGTT

Gene: Rmet_2303: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -63
score = 6.1543
sequence = ACTCTATAGTAACTAGAGGGT

Gene: Rmet_5947: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Site:
position = -63
score = 6.1543
sequence = ACTCTATAGTAACTAGAGGGT

Gene: pMOL30_091: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
 
Ralstonia solanacearum GMI1000
 2
Ralstonia pickettii 12J

Gene: Rpic_1814: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Rpic_1644: Lipoprotein signal peptidase (EC 3.4.23.36)
 3
Ralstonia metallidurans CH34

Gene: Rmet_5948: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Rmet_2304: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: pMOL30_090: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Lipoprotein signal peptidase (EC 3.4.23.36)
pbrD
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_5949: Pb(II) binding protein
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Pb(II) binding protein
 
CRON 3.
pbrR
 
Ralstonia solanacearum GMI1000
*2
Ralstonia pickettii 12J

Site:
position = -43
score = 6.15292
sequence = ACTCTATAGCTACTATAGAGT

Gene: Rpic_1642: Lead resistance transcriptional regulator, MerR family

Site:
position = -43
score = 6.15292
sequence = ACTCTATAGCTACTATAGAGT

Gene: Rpic_1816: Lead resistance transcriptional regulator, MerR family
*2
Ralstonia metallidurans CH34

Site:
position = -44
score = 6.1543
sequence = ACCCTCTAGTTACTATAGAGT

Gene: pMOL30_092: Lead resistance transcriptional regulator, MerR family

Site:
position = -44
score = 6.1543
sequence = ACCCTCTAGTTACTATAGAGT

Gene: Rmet_5946: Lead resistance transcriptional regulator, MerR family
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Lead resistance transcriptional regulator, MerR family
pbrT
 
Ralstonia solanacearum GMI1000
 2
Ralstonia pickettii 12J

Gene: Rpic_1817: Pb(II) uptake protein, ILT family

Gene: Rpic_1641: Pb(II) uptake protein, ILT family
 2
Ralstonia metallidurans CH34

Gene: pMOL30_093: Pb(II) uptake protein, ILT family

Gene: Rmet_5945: Pb(II) uptake protein, ILT family
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Pb(II) uptake protein, ILT family
 
CRON 4.
Rpic_1752
 
Ralstonia solanacearum GMI1000
*
Ralstonia pickettii 12J

Site:
position = -115
score = 5.97091
sequence = ACCCTGTAGTCACTACAGACT

Gene: Rpic_1752: hypothetical protein
*
Ralstonia metallidurans CH34

Site:
position = -115
score = 5.97091
sequence = ACCCTGTAGTCACTACAGACT

Gene: Rmet_5969: hypothetical protein
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
hypothetical protein
 
CRON 5.
cadA
*
Ralstonia solanacearum GMI1000

Site:
position = -57
score = 5.64595
sequence = ACCCTGGAGTTCCTTCAGGGT

Gene: RS05448: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Ralstonia pickettii 12J

Site:
position = -34
score = 5.63839
sequence = ACCCTGGAGCTTCTTCAGGGT

Gene: Rpic_4809: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Ralstonia metallidurans CH34

Site:
position = -46
score = 6.06593
sequence = ACCCTGTAGCGACTAAAGGGT

Gene: Rmet_4594: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Ralstonia eutropha JMP134

Site:
position = -61
score = 6.2636
sequence = ACTCTGTAGCGGCTACAGGGT

Gene: Reut_B3972: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Ralstonia eutropha H16

Site:
position = -61
score = 6.40785
sequence = ACTCTGTAGTCGCTACAGGGT

Gene: H16_B1644: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
*
Cupriavidus taiwanensis

Site:
position = -61
score = 6.40785
sequence = ACTCTGTAGCCACTACAGGGT

Gene: RALTA_B1454: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD