Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CadR-PbrR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32 16 4
Shewanella sp W3-18-1 11 4
Shewanella sp ANA-3 1 1
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400 2 1
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD2
 
Shewanella oneidensis MR-1
*2
Shewanella putrefaciens CN-32

Site:
position = -61
score = 5.61753
sequence = ACCTTATAGTGACTTTATAGT

Gene: Sputcn32_0221: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.61753
sequence = ACCTTATAGTGACTTTATAGT

Gene: Sputcn32_0195: Co/Zn/Cd efflux protein
*3
Shewanella sp W3-18-1

Site:
position = -61
score = 5.61753
sequence = ACCTTATAGTGACTTTATAGT

Gene: Sputw3181_0520: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.61753
sequence = ACCTTATAGTGACTTTATAGT

Gene: Sputw3181_0414: Co/Zn/Cd efflux protein

Site:
position = -61
score = 5.61753
sequence = ACCTTATAGTGACTTTATAGT

Gene: Sputw3181_0439: Co/Zn/Cd efflux protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Co/Zn/Cd efflux protein
lspA
 
Shewanella oneidensis MR-1
 2
Shewanella putrefaciens CN-32

Gene: Sputcn32_0222: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Sputcn32_0196: Lipoprotein signal peptidase (EC 3.4.23.36)
 3
Shewanella sp W3-18-1

Gene: Sputw3181_0440: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Sputw3181_0519: Lipoprotein signal peptidase (EC 3.4.23.36)

Gene: Sputw3181_0415: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Lipoprotein signal peptidase (EC 3.4.23.36)
 
CRON 2.
cadA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -61
score = 5.84283
sequence = ACTCTATAGTGACTATAGAGA

Gene: Sfri_3462: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_4320: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3463: Lipoprotein signal peptidase (EC 3.4.23.36)
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Lipoprotein signal peptidase (EC 3.4.23.36)
 
CRON 3.
czcD
 
Shewanella oneidensis MR-1
*2
Shewanella putrefaciens CN-32

Site:
position = -59
score = 6.35953
sequence = ACTCTATAGTAACTACAGAGT

Gene: Sputcn32_0229: Co/Zn/Cd efflux protein

Site:
position = -59
score = 6.35953
sequence = ACTCTATAGTAACTACAGAGT

Gene: Sputcn32_1972: Co/Zn/Cd efflux protein
*
Shewanella sp W3-18-1

Site:
position = -59
score = 6.35953
sequence = ACTCTATAGTAACTACAGAGT

Gene: Sputw3181_1169: Co/Zn/Cd efflux protein
*
Shewanella sp ANA-3

Site:
position = -57
score = 6.29717
sequence = ACTCTATAGTAACTATAGAGT

Gene: Shewana3_4157: Co/Zn/Cd efflux protein
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Co/Zn/Cd efflux protein
Sputcn32_0228
 
Shewanella oneidensis MR-1
 2
Shewanella putrefaciens CN-32

Gene: Sputcn32_0228: hypothetical protein

Gene: Sputcn32_1971: hypothetical protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1168: hypothetical protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
hypothetical protein
czcC
 
Shewanella oneidensis MR-1
 2
Shewanella putrefaciens CN-32

Gene: Sputcn32_0227: Heavy metal RND efflux outer membrane protein

Gene: Sputcn32_1970: Heavy metal RND efflux outer membrane protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1167: Heavy metal RND efflux outer membrane protein
 
Shewanella sp ANA-3

Gene: Shewana3_4156: Heavy metal RND efflux outer membrane protein
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3455: Heavy metal RND efflux outer membrane protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_0385: Heavy metal RND efflux outer membrane protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3906: Heavy metal RND efflux outer membrane protein
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Heavy metal RND efflux outer membrane protein
czcB
 
Shewanella oneidensis MR-1
 2
Shewanella putrefaciens CN-32

Gene: Sputcn32_0226: Heavy metal efflux RND transporter, membrane fusion protein

Gene: Sputcn32_1969: Heavy metal efflux RND transporter, membrane fusion protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1166: Heavy metal efflux RND transporter, membrane fusion protein
 
Shewanella sp ANA-3

Gene: Shewana3_4155: Heavy metal efflux RND transporter, membrane fusion protein
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3456: Heavy metal efflux RND transporter, membrane fusion protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_0386: Heavy metal efflux RND transporter, membrane fusion protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3905: Heavy metal efflux RND transporter, membrane fusion protein
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Heavy metal efflux RND transporter, membrane fusion protein
czcA
 
Shewanella oneidensis MR-1
 2
Shewanella putrefaciens CN-32

Gene: Sputcn32_0225: Heavy metal efflux RND transmembrane protein

Gene: Sputcn32_1968: Heavy metal efflux RND transmembrane protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1165: Heavy metal efflux RND transmembrane protein
 
Shewanella sp ANA-3

Gene: Shewana3_4154: Heavy metal efflux RND transmembrane protein
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3457: Heavy metal efflux RND transmembrane protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_0387: Heavy metal efflux RND transmembrane protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3904: Heavy metal efflux RND transmembrane protein
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Heavy metal efflux RND transmembrane protein
Sputcn32_1967
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1967: hypothetical protein
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
hypothetical protein
cadA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1966: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD