Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444 1 1
Sphingopyxis alaskensis RB2256 2 2
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1 1 1
Zymomonas mobilis subsp. mobilis ZM4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
grxC
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -36
score = 5.99593
sequence = ACTCCGTACCATGGTACGCAAG

Gene: Saro_2123: Glutaredoxin
*2
Sphingopyxis alaskensis RB2256

Site:
position = -10
score = 6.48361
sequence = ACTCCGTACTATGGTACGGAGC

Gene: Sala_2436: Glutaredoxin

Site:
position = -35
score = 6.01787
sequence = ACTCCGTACCATGGTACGGATG

Gene: Sala_1624: Glutaredoxin
 
Sphingobium japonicum UT26S
*
Sphingomonas wittichii RW1

Site:
position = -65
score = 4.06175
sequence = CAACCGTACCATGGTACAGCCC

Gene: Swit_1124: Glutaredoxin
 
Zymomonas mobilis subsp. mobilis ZM4
Glutaredoxin
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD