Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1
Thauera sp. MZ1T
Dechloromonas aromatica RCB
Nitrosomonas europaea ATCC 19718 5 1
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans 3 1
Chromobacterium violaceum ATCC 12472
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9
Methylobacillus flagellatus KT
Methylotenera mobilis JLW8
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
merT
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
*
Nitrosomonas europaea ATCC 19718

Site:
position = -63
score = 6.1447
sequence = ACTCCGTACATGACTACGGAAG

Gene: NE0842: Mercury uptake inner membane protein
 
Nitrosospira multiformis ATCC 25196
*
Thiobacillus denitrificans

Site:
position = -52
score = 6.20954
sequence = ACTCCGTACATAACTACGGAAA

Gene: Tbd_1339: Mercury uptake inner membane protein
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Mercury uptake inner membane protein
merP
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE0841: Periplasmic mercury (+2) binding protein
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1340: Periplasmic mercury (+2) binding protein
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Periplasmic mercury (+2) binding protein
merC
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE0840: Mercury uptake inner membane protein
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Mercury uptake inner membane protein
merA
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE0839: Mercuric ion reductase (EC 1.16.1.1)
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1341: Mercuric ion reductase (EC 1.16.1.1)
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Mercuric ion reductase (EC 1.16.1.1)
merD
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718

Gene: NE0838: Mercuric resistance operon coregulator
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Mercuric resistance operon coregulator
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD