Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42 5 2
Comamonas testosteroni KF-1 6 1
Delftia acidovorans SPH-1 3 1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666 8 2
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1 2 1
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
merT
 
Acidovorax avenae subsp. citrulli AAC00-1
*2
Acidovorax sp. JS42

Site:
position = -34
score = 6.54199
sequence = ACTCCGTACTTAACTACGGAAG

Gene: Ajs_1475: Mercury uptake inner membane protein

Site:
position = -63
score = 6.17332
sequence = ACTCCGTAGTTGACTACGGAAG

Gene: Ajs_1300: Mercury uptake inner membane protein
*
Comamonas testosteroni KF-1

Site:
position = -63
score = 6.32981
sequence = ACTCCGTACATAACTACGGAAG

Gene: CtesDRAFT_1787: Mercury uptake inner membane protein
*
Delftia acidovorans SPH-1

Site:
position = -63
score = 6.17332
sequence = ACTCCGTAGTTGACTACGGAAG

Gene: Daci_0485: Mercury uptake inner membane protein
 
Polaromonas naphthalenivorans CJ2
*2
Polaromonas sp. JS666

Site:
position = -34
score = 6.72555
sequence = ACTCCGTACTTAAGTACGGAAG

Gene: Bpro_4797: Mercury uptake inner membane protein

Site:
position = -63
score = 6.10436
sequence = ACTCCGTACATTACTACGGAAA

Gene: Bpro_2231: Mercury uptake inner membane protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
*
Methylibium petroleiphilum PM1

Site:
position = -57
score = 5.64831
sequence = ACTCCGTACTCAGGTACGTACC

Gene: Mpe_A1662: Mercury uptake inner membane protein
 
Leptothrix cholodnii SP-6
Mercury uptake inner membane protein
merP
 
Acidovorax avenae subsp. citrulli AAC00-1
 2
Acidovorax sp. JS42

Gene: Ajs_1476: Periplasmic mercury (+2) binding protein

Gene: Ajs_1299: Periplasmic mercury (+2) binding protein
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1786: Periplasmic mercury (+2) binding protein
 
Delftia acidovorans SPH-1

Gene: Daci_0484: Periplasmic mercury (+2) binding protein
 
Polaromonas naphthalenivorans CJ2
 2
Polaromonas sp. JS666

Gene: Bpro_4796: Periplasmic mercury (+2) binding protein

Gene: Bpro_2230: Periplasmic mercury (+2) binding protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1663: Periplasmic mercury (+2) binding protein
 
Leptothrix cholodnii SP-6
Periplasmic mercury (+2) binding protein
merC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1785: Mercury uptake inner membane protein
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_2229: Mercury uptake inner membane protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Mercury uptake inner membane protein
merA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_1298: Mercuric ion reductase (EC 1.16.1.1)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1784: Mercuric ion reductase (EC 1.16.1.1)
 
Delftia acidovorans SPH-1

Gene: Daci_0483: Mercuric ion reductase (EC 1.16.1.1)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_2228: Mercuric ion reductase (EC 1.16.1.1)
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Mercuric ion reductase (EC 1.16.1.1)
merD
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1783: Mercuric resistance operon coregulator
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_2227: Mercuric resistance operon coregulator
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Mercuric resistance operon coregulator
merE
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1782: Putative mercury resistance protein
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_2226: Putative mercury resistance protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Putative mercury resistance protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD