Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243
Burkholderia mallei ATCC 23344
Burkholderia sp. 383
Burkholderia cepacia AMMD
Burkholderia vietnamiensis G4
Burkholderia glumae BGR1 2 1
Burkholderia xenovorans LB400 8 2
Burkholderia phymatum STM815
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
merT
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
*2
Burkholderia xenovorans LB400

Site:
position = -57
score = 5.78517
sequence = ACTCCGTACTCAGGTACGCACC

Gene: Bxe_A0238: Mercury uptake inner membane protein

Site:
position = -63
score = 6.1447
sequence = ACTCCGTACATGACTACGGAAG

Gene: Bxe_C1216: Mercury uptake inner membane protein
 
Burkholderia phymatum STM815
Mercury uptake inner membane protein
merP
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 2
Burkholderia xenovorans LB400

Gene: Bxe_A0239: Periplasmic mercury (+2) binding protein

Gene: Bxe_C1215: Periplasmic mercury (+2) binding protein
 
Burkholderia phymatum STM815
Periplasmic mercury (+2) binding protein
merC
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
*
Burkholderia glumae BGR1

Site:
position = -152
score = 5.98822
sequence = ACTCCGTAGTCGACTACGGAAG

Gene: bglu_2p0790: Mercury uptake inner membane protein
 
Burkholderia xenovorans LB400

Gene: Bxe_C1214: Mercury uptake inner membane protein
 
Burkholderia phymatum STM815
Mercury uptake inner membane protein
merA
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1

Gene: bglu_2p0780: Mercuric ion reductase (EC 1.16.1.1)
 
Burkholderia xenovorans LB400

Gene: Bxe_C1213: Mercuric ion reductase (EC 1.16.1.1)
 
Burkholderia phymatum STM815
Mercuric ion reductase (EC 1.16.1.1)
merD
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_C1212: Mercuric resistance operon coregulator
 
Burkholderia phymatum STM815
Mercuric resistance operon coregulator
merE
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_C1211: Putative mercury resistance protein
 
Burkholderia phymatum STM815
Putative mercury resistance protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD