Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c
Xanthomonas axonopodis pv. citri str. 306
Xanthomonas campestris pv. campestris str. ATCC 33913
Stenotrophomonas maltophilia K279a 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
merT
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -66
score = 6.35688
sequence = ACTCCGTACTTGACTACGGAAG

Gene: Smlt2410: Mercury uptake inner membane protein
Mercury uptake inner membane protein
merP
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2411: Periplasmic mercury(+2) binding protein
Periplasmic mercury(+2) binding protein
merA
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2412: Mercuric ion reductase (EC 1.16.1.1)
Mercuric ion reductase (EC 1.16.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD