Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas putida KT2440
Pseudomonas syringae pv. tomato str. DC3000
Pseudomonas fluorescens Pf-5
Pseudomonas mendocina ymp
Pseudomonas stutzeri A1501 2 1
Azotobacter vinelandii AvOP
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
merT
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
*
Pseudomonas stutzeri A1501

Site:
position = -61
score = 6.75485
sequence = ATTCCGTACTTTGGTACGGAGT

Gene: PST_3432: Mercury uptake inner membane protein
 
Azotobacter vinelandii AvOP
Mercury uptake inner membane protein
merP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501

Gene: PST_3433: Periplasmic mercury(+2) binding protein
 
Azotobacter vinelandii AvOP
Periplasmic mercury(+2) binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD