Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei 12 3
Marinobacter sp. ELB17 10 2
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
merT
 
Hahella chejuensis KCTC 2396
*3
Marinobacter aqueolei

Site:
position = -65
score = 6.35688
sequence = ACTCCGTACTTGACTACGGAAG

Gene: Maqu_4013: Mercury uptake inner membane protein

Site:
position = -65
score = 5.7026
sequence = ATTCCGTAGCTGACTACGGGAG

Gene: Maqu_0239: Mercury uptake inner membane protein

Site:
position = -65
score = 6.13309
sequence = ACTCCGTAGCTGACTACGGAAG

Gene: Maqu_1394: Mercury uptake inner membane protein
*
Marinobacter sp. ELB17

Site:
position = -65
score = 5.7026
sequence = ATTCCGTAGCTGACTACGGGAG

Gene: MELB17_00680: Mercury uptake inner membane protein
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Mercury uptake inner membane protein
merP
 
Hahella chejuensis KCTC 2396
 3
Marinobacter aqueolei

Gene: Maqu_4012: Periplasmic mercury(+2) binding protein

Gene: Maqu_0240: Periplasmic mercury(+2) binding protein

Gene: Maqu_1393: Periplasmic mercury(+2) binding protein
*2
Marinobacter sp. ELB17

Site:
position = -220
score = 5.7026
sequence = ATTCCGTAGCTGACTACGGGAG

Gene: MELB17_23165: Periplasmic mercury(+2) binding protein

Gene: MELB17_00675: Periplasmic mercury(+2) binding protein
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Periplasmic mercury(+2) binding protein
merF
 
Hahella chejuensis KCTC 2396
 2
Marinobacter aqueolei

Gene: Maqu_4011: Putative mercury resistance protein

Gene: Maqu_0241: Putative mercury resistance protein
 2
Marinobacter sp. ELB17

Gene: MELB17_23160: Putative mercury resistance protein

Gene: MELB17_00670: Putative mercury resistance protein
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Putative mercury resistance protein
merA
 
Hahella chejuensis KCTC 2396
 3
Marinobacter aqueolei

Gene: Maqu_4010: Mercuric ion reductase (EC 1.16.1.1)

Gene: Maqu_0242: Mercuric ion reductase (EC 1.16.1.1)

Gene: Maqu_1392: Mercuric ion reductase (EC 1.16.1.1)
 2
Marinobacter sp. ELB17

Gene: MELB17_23155: Mercuric ion reductase (EC 1.16.1.1)

Gene: MELB17_00665: Mercuric ion reductase (EC 1.16.1.1)
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Mercuric ion reductase (EC 1.16.1.1)
merB
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_0243: Organomercurial lyase (EC 4.99.1.2)
 
Marinobacter sp. ELB17

Gene: MELB17_00660: Organomercurial lyase (EC 4.99.1.2)
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Organomercurial lyase (EC 4.99.1.2)
merD
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_00655: Mercuric resistance operon coregulator
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Mercuric resistance operon coregulator
merP2
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_23150: Periplasmic mercury(+2) binding protein
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Periplasmic mercury(+2) binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD